Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer pairs used for qPCR.
| Gene | Forward primer | Reverse primer |
|---|---|---|
| AR | gatggcctgaagaaccagaa | gaaatgatggccgagatca |
| ERα | ttcaaggggaggaatttgtg | tgtccagaacacggtggata |
| HMBS | cctcagctagaattcagggatatt | gattctcccagcccattctc |
| YWHAZ | gttgctgctggagatgacaa | atctgatcggatgtgttggc |
