Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used for qRT-PCR analysis
| Gene | Primer | Oligonucleotide | Product Size |
|---|---|---|---|
| ENKUR | Forward (5'-3') | TATGGCCGGGGAGAAATAGG | 473 bp |
| Reverse (3'-5') | GTTTTTCGGACGACACGGTA | ||
| β-ACTIN | Forward (5'-3') | AGCGGGAAATCGTGCGTG | 309 bp |
| Reverse (3'-5') | CAGGGTACATGGTGGTGCC |
