Skip to main content
. 2018 Jul 25;38(30):6700–6721. doi: 10.1523/JNEUROSCI.0672-18.2018

Table 1.

List of shRNA constructs

shRNA construct Virus type Target nucleotide sequence (5′-3′) Reference Full name
L-309 sh-PTPσ Lentivirus GCCACACACCTTCTATAAT Yim et al., 2013 Protein tyrosine phosphatase, receptor type, S (Ptprs)
L-309 sh-PTPδ Lentivirus GTGCCGGCTAGAAACTTG Yim et al., 2013 Protein tyrosine phosphatase, receptor type, D (Ptprd)
L-309 sh-LAR Lentivirus GCCTACATAGCTACACAG Yim et al., 2013 Leukocyte common antigen-related phosphatase (LAR)
L-315 sh-β-catenin Lentivirus GCAATCAGCTGGCCTGGTTTG Current study β-Catenin (Ctnnb1)
L-315 sh-p250RhoGAP Lentivirus ACAAGAAGCACCAAGTA Nakazawa et al., 2008 Rho GTPase activating protein 32 (Arhgap32)
L-315 sh-Lipirin-α2 Lentivirus AGCCAGTCTGATTACAGAA Current study PTPRF-interacting protein α2 (Ppfia2)
L-315 sh-Lipirin-α3 Lentivirus GCTAACATGAAGAAGCTTCAA Current study PTPRF-interacting protein α3 (Ppfia3)
L-315 sh-N-cadherin Lentivirus GGACAACTGTCAGTCACAAAG Current study Cadherin 2