Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
RT-PCR primers.
| Genes | Upstream (5′-3′) | Downstream (5′-3′) |
|---|---|---|
| Per1 | ccatggacatgtctact | agaggaccaggggacat |
| Per2 | ctacctggtcaaggtgcaagag | ggtttgaatcttgccactgg |
| Per3 | tcctgatggtaagacattccag | gcgtgaacaatcacactcactt |
| Cry1 | cgtctgtttgtgattcgggg | attcacgccacaggagttgc |
| Cry2 | agaaggtgaagaggaacagcac | tagatgtatcgagaggggaagc |
| Arntl/Bmal1 | tcaagaatgcaagggaggcc | aacaggtagaggcgaagtcc |
| Clock | ctatgcttcctggtaacgcg | gcctattattggtggtgccc |
| Gapdh | tgaaggtcggtgtgaacggatttggc | tgaaggtcggtgtgaacggatttggc |
