Table 1. Primers sequences, nested PCR and sequencing conditions.

Primer sequences	Activities	Procedure conditions	Size of PCR products
K1-F: 5’- cggagtgaccaaatctggga-3’ K4-R: 5’- gggaatctggtggtaacagc-3’	Nested PCR	95°C×2 min, 30 cycles [95°C×30 sec, 60°C×90 sec, 72°C × 90 sec], 72°C ×10 min	2097 bp
K2-F: 5’- gccaagctgccattcatttg -3’ K3-R: 5’-gccttgttgaaagaagcaga-3’		95°C×2 min, 30 cycles [95°C×30 sec, 60°C×90 sec, 72°C × 90 sec], 72°C ×10 min	850 bp
K2-F: 5’- gccaagctgccattcatttg -3’ K3-R: 5’-gccttgttgaaagaagcaga-3’ K5-F: 5’-ttatgtcattggtggaactaa-3’ K6-R: 5’-tctaggggtattcaaaggtgc-3’	Sequencing	ABI 3730XL automatic sequencer