Table 1.

Summary of off-target sites (OT’s) above level of detection (>0.1%)

Target	Sequence	Closest gene	Feature	% Reads with Indels
				Mock	WT1	WT2	HF1	HF2
CCR5	GCAGCATAGTGAGCCCAGAAGGG	CCR5	Exon	0.128	93.41	95.832	92.377	93.078
CCR5_OT3	ACAGAATAGAGAGCCCAGAAAGG	GRID1	Intergenic	0	0.467	0.434	0.03	0.045
CCR5_OT14	ACAGCATAGAGGGCCCAGAAGGG	SUOX	Exon	0	0.105	0.128	0.095	0.051
CCR5_OT39	ACAGCATAGTGAACCCAGGAGGG	TBPL2	Intergenic	0.017	0.388	0.302	0.102	0.052
CCR5_OT40	GCTGCATAGTGAACCCAGTATGG	ZNF609	Intergenic	0.032	0.122	0.245	0.031	0.014

PAM sequences are shown as bold and mismatched bases are shown as italics. For all of these sites the percent of Indels was   <0.5% using wild type (WT) Cas9. For 4 of these sites, the use of the HiFi Cas9 abolished off-target activity