REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Bacterial and Virus Strains | ||
Mycobacterium marinum M strain transformed with pMSP12:tdTomato | Takaki et al., 2013 | derivatives of ATCC #BAA-535 |
M. marinum M strain transformed with pMSP12:EBFP2 | Takaki et al., 2013 | derivatives of ATCC #BAA-535 |
M. marinum M strain transformed with pMSP12:tdKatushka | Takaki et al., 2013 | derivatives of ATCC #BAA-535 |
M. marinum M strain transformed with pMSP12:wasabi | Takaki et al., 2013 | derivatives of ATCC #BAA-535 |
M. tuberculosis ΔleuD ΔpanCD double auxotroph strain transformed with pMSP12:mCherry | A. Floto Laboratory | N/A |
M. tuberculosis ΔleuDΔpanCD double auxotroph strain transformed with pMSP12:GFP | A. Floto Laboratory | N/A |
Chemicals, Peptides, and Recombinant Proteins | ||
Zebrafish recombinant TNF | Roca et al., 2008 | N/A |
Pepstatin A | Sigma-Aldrich | Cat#P4265; CAS: 26305-03-3 |
E64d | Sigma-Aldrich | Cat#E8640; CAS: 88321-09-9 |
BI-6C9 | Sigma-Aldrich | Cat#B0186; CAS: 791835-21-7 |
(S)-(+)-Camptothecin (CPT) | Alfa Aesar | Cat#J62523; CAS: 7689-03-4 |
Acridine orange (2% solution in H2O) | Sigma-Aldrich | Cat#A9231; CAS: 65-61-2 |
BCB (Bax Channel Blocker) | Alfa Aesar | Cat#J64257 |
Rhod-2, AM, cell permeant | Fisher Scientific | Cat#R1245MP |
Ru360 | VWR International | Cat#557440 |
Amifostine | Cambridge Bioscience | Cat#14398-50mg-CAY |
NAC (N-Acetyl-L-Cysteine) | Cambridge Bioscience | Cat#A0918-10 g |
Mitotempo | Cambridge Bioscience | Cat#16621-5mg-CAY |
GSH | Cambridge Bioscience | Cat#1242-1 |
Alisporivir | Novartis | Roca and Ramakrishnan, 2013 |
Xestospongin C (XestC) | Cambridge Bioscience | Cat#64950-10 ug-CAY |
Ryanodine | Generon | Cat#2489-500 |
Dantrolene sodium salt | Sigma-Aldrich | Cat#D9175-1G; CAS: 14663-23-1 |
Nifedipine | Cambridge Bioscience | Cat#N3228-1 g |
Diltiazem | Cambridge Bioscience | Cat#D3447-1 g |
Verapamil HCl | Fisher Scientific | Cat#10403045 |
Thapsigargin | Sigma-Aldrich | Cat#T9033-.5MG; CAS: 67526-95-8 |
4-Chloro-m-cresol (4CmC) | Sigma-Aldrich | Cat#55402-5G; CAS: 59-50-7 |
MitoTracker Red CM-H2Xros | Fisher Scientific | Cat# M7513 |
MitoSOX | Fisher Scientific | Cat#M36008 |
Desipramine hydrochloride | Sigma-Aldrich | Cat#D3900-5G; CAS: 58-28-6 |
Necrostatin-1 | Alfa Aesar | Cat#J65341.F+; CAS: 4311-88-0 |
Necrosulfonamide (NSA) | Cambridge Bioscience | Cat#20844-5mg-CAY; CAS: 1360614-45-7 |
PTU (1-phenyl-2-thiourea) | Sigma-Aldrich | Cat#P7629; CAS: 103-85-5 |
Tango Buffer (10x) | Thermo Scientific | Cat#BY5 |
PMA (Phorbol 12-myristate 13-acetate) | Sigma-Aldrich | Cat#P1585-1MG; CAS: 16561-29-8 |
Human recombinant TNF | Sigma-Aldrich | Cat#SRP3177-50UG |
D (+) Trehalose dehydrate | Sigma-Aldrich | Cat#T0167-10G |
Nec-1 s | Cambridge Bioscience | Cat#2263-5 |
Q-VD-OPh | Source Bioscience | Cat#ABE283 |
Z-VAD-FMK | Cambridge Bioscience | Cat#14463-1MG-CAY |
SYTOX® Green Nucleic Acid Stain | Life Technologies | Cat#S7020 |
Gibson Assembly | ||
NEBuilder HiFi DNA Assembly Master Mix | New England Biolabs | Cat#E2621 |
RNeasy Mini Kit | QIAGEN | Cat#74104 |
mMessage mMachine kit | Ambion | N/A |
polyA Tailing kit | Ambion | N/A |
Experimental Models: Cell Lines | ||
THP-1 human monocytic cell line | ATCC | TIB-202 |
Experimental Models: Organisms/Strains | ||
Zebrafish (Danio rerio): wild type AB strain | University of Cambridge | ZFIN ID: ZDB-GENO-960809-7 |
Zebrafish: Tg(mpeg1:YFP)w200 | Roca and Ramakrishnan, 2013 | ZFIN ID: ZDB-FISH-150901-6828 |
Zebrafish: Tg(mpeg1:Brainbow)w201 | Pagán et al., 2015 | ZFIN ID: ZDB-FISH-151204-7 |
Zebrafish: baxarr1 | This work | N/A |
Zebrafish: baxbrr10 | This work | N/A |
Zebrafish: ripk3rr7 | This work | N/A |
Zebrafish: Tg(BH:GFP-mfap4:Mito-GCaMP3) | This work | N/A |
Oligonucleotides | ||
Morpholino: Cathepsin D E2/I2 TGTCAGCAA GCAGATACTCACATCT |
Gene Tools; Follo et al., 2011 | ZDB-MRPHLNO-110722-2 |
Morpholino: BID GGTCAAAGTTCCTGTTGAAGTCCAT | Gene Tools; Kratz et al., 2006 | ZDB-MRPHLNO-070126-2 |
Morpholino: PGAM5 AGCGCCCTCCGAAAA GACATGCTTC |
Roca and Ramakrishnan, 2013 | ZDB-MRPHLNO-130820-4 |
Morpholino: cyclophilin D-ATG TTGGGTTTG ACATTTTCTTAGAT |
Gene Tools; Roca and Ramakrishnan, 2013 | ZDB-MRPHLNO-130820-5 |
Baxarr1 forward primer for genotyping by HRM, sequence: 5′-GACCTCTGCCTCTTGCAGCTT-3′ | This work | N/A |
Baxarr1 reverse primer for genotyping by HRM, sequence: 5′-GCAAACACTGCGCGAGGCGTT-3′ | This work | N/A |
Baxbrr10 forward primer for genotyping by HRM, sequence: 5′-GTTGCATCAAGTTTATGAGGTGTTG-3′ | This work | N/A |
Baxbrr10 reverse primer for genotyping by HRM, sequence: 5′-CAGGGTAGTAAGGCAGGAG CTAATGG-3′ |
This work | N/A |
RIPK3rr7 forward primer for genotyping by HRM, sequence: 5′-AGAGAAGCGGAGCTGATGTTTGAT-3′ | This work | N/A |
RIPK3rr7 reverse primer for genotyping by HRM, sequence: 5′-CTTGGCATCCAGGCTGTCACTCAGC-3′ | This work | N/A |
Recombinant DNA | ||
Zebrafish full-length BAX | This work | N/A |
Zebrafish ΔBH3-BAX | This work | N/A |
Zebrafish MOM-ΔBH3-BAX | This work | N/A |
Zebrafish ER-ΔBH3-BAX | This work | N/A |
Zebrafish MOM-full-length BAX | This work | N/A |
Zebrafish TMBIM3 | This work | N/A |
Zebrafish TMBIM6 | This work | N/A |
Venus-V2A-BH4 (from BC-L2) | This work | N/A |
pTol2-PhiC31LS-BH:GFP-mfap4:Mito-GCaMP3 | This work | N/A |
pME mitoGCaMP3 | D. Raible Laboratory; Esterberg et al., 2014 | N/A |
pTol2 PhiC31LS BH NewMCS (cmlc2:eGFP) | This work | N/A |
pTol2 PhiC31LS BH NewMCS (cmlc2:RFP) | This work | N/A |
pTol2 mfap4:TdTomato-CAAX | D. Tobin Laboratory; Walton et al., 2015 | N/A |
pSB_PhiC31LandingSite | Kirchmaier et al., 2013 | Addgene #48875 |
pCS2P+ | Marc Kirschner | Addgene #17095 |
Software and Algorithms | ||
NIS-Elements | Nikon | N/A |
Imaris | Bitplane | N/A |
Prism | GraphPad | N/A |
ImageJ | https://imagej.nih.gov/ij/ | N/A |
FPC (ImageJ); macro for quantification of bacterial burden by fluorescence imaging used in this work for quantification of camptothecin-induced apoptosis | Takaki et al., 2013 | N/A |
CorelDraw X5 | Corel | N/A |