Table 1.
Number | Sequence | Sense/antisense | Position1-a | Exon1-b |
---|---|---|---|---|
P1 | ATGCCCATCCTGGAAAAGGCTCCC | Sense | 202–225 | 2 |
P2 | TGGGTCTCTGAATACTGGCTGAATG | Sense | 454–478 | 3–4 |
P3 | AACATTTCAACCTCAACCTTCTGG | Antisense | 1317–1340 | 10 |
P4 | CTCACTCACTGAGTCAGCCCTGAC | Antisense | 1282–1305 | 10 |
The number of nucleic acids is based on the rat ChAT cDNA sequence reported by Brice et al. (1989).
Exon organization of the rat ChAT gene is based on the report by Hahn et al. (1992).