Skip to main content
. 2019 Sep 17;8:e47155. doi: 10.7554/eLife.47155

Key resources table.

Reagent type
(species) or resource
Designation Source or
reference
Identifiers Additional
information
Genetic reagent (Pristionchus pacificus) Ppa-daf-6p::rfp this study tuEx231 extrachromosomal array transgenic strain
Genetic reagent (Pristionchus pacificus) Ppa-daf-6p::venus this study tuEx250 extrachromosomal array transgenic strain
Genetic reagent (Pristionchus pacificus) Ppa-odr-3p::rfp this study tuEx265 extrachromosomal array transgenic strain
Genetic reagent (Pristionchus pacificus) Ppa-odr-7p::rfp this study tuEx296 and tuEx297 extrachromosomal array transgenic strain
Genetic reagent (Pristionchus pacificus) Ppa-che-1p::che-1:rfp this study lucEx367 extrachromosomal array transgenic strain
Recombinant DNA reagent Ppa-che-1 mRNA probe Stellaris, Biosearch Technologies; this study PPA01143 single-molecule in situ fluorescence probe
Sequence-based reagent Ppa-daf-6 promoter forward primer this study PPA15978 CTCGCCCGTGGATCATGTG
Sequence-based reagent Ppa-daf-6 promoter reverse primer this study PPA15978 TGCAAATCATTGATTGAATCATGG
Sequence-based reagent Ppa-odr-3 promoter forward primer this study PPA14189 GAGCGAGTGAAATGAGCTCAGTCC
Sequence-based reagent Ppa-odr-3 promoter reverse primer this study PPA14189 GGGTGATCGATACGAGGAGTGTTC
Sequence-based reagent Ppa-odr-7 promoter forward primer this study Contig1-aug1055.t1 AACCAATGCATTGGCTTAGTTGGTTTCACTAATCACTACTG
Sequence-based reagent Ppa-odr-7 promoter reverse primer this study Contig1-aug1055.t1 CCCTTGTCATTCAGATGAGCGAGCTGATCAAGGAG
Sequence-based reagent Ppa-che-1 promoter reverse primer this study PPA01143 CAGGAAACAGCTATGACCATG
Sequence-based reagent Ppa-che-1 intron reverse primer this study PPA01143 CTGTGATAAGATCATTATTGGTAC
Chemical compound, drug DiI Molecular Probe V22889 1:150 dilution
Chemical compound, drug DiO Molecular Probe V22886 1:150 dilution
Software, algorithm TrakEM2 PMID: 22723842 EM section alignment
Software, algorithm 3D reconstruction bioRxiv 485771 volumetric reconstruction
Software, algorithm Photoshop Adobe image processing
Software Image J Imagej.net image processing
Algorithm www.phylogeny.fr PMID: 18424797 maximum liklihood phylogeny