Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Designing reverse and forward primers of microneme (MIC) gene with HindIII and EcoRV sequences that were added to reverse and forward primers, respectively
| Primer | The restriction enzymes site that added to primers | Nucleotide No | Sequence of Primers |
|---|---|---|---|
| Forward | HindIII | 31 nucleotides | 5΄- CACA ↓ A GCTTATGGCGCTCACCTTCATGGGGG - 3΄ |
| Reverse | EcoRV | 32 nucleotide | 5΄- ACAGAT ↓ ATCTCACGTCACGGTGTGGGCATGGT - 3΄ |
