Table 2.
Specifications of miR-27a/b-3p.
| Name | Sequence | MirBase ID |
|---|---|---|
| hsa-miR-27a-3p | uucacaguggcuaaguuccgc | MIMAT0000084 |
| hsa-miR-27b-3p | uucacaguggcuaaguucugc | MIMAT0000419 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.