Table 2.

List of arsenic-responsive small RNAs targeting protein-coding transcripts in rice.

Small RNA IDs	Small RNA sequences	CK_root1	As_root2	CK_shoot3	As_shoot4	Control5	AGO1a6	AGO1b7	AGO1c8
root-CK-high-10130	UAUGACGCUGUUGACUUUUAG	3.25	0	1.1	1.18	8.69	141.39	2.44	32.38
root-CK-high-10257 (osa-miR396a-5p/osa-miR396b-5p)	UUCCACAGCUUUCUUGAACUG	23.74	1.43	1.1	0.39	108.95	1738.59	907.64	290.36
root-CK-high-10864	CUUUGGAUUGAAGGGAGCUCU	7.28	0.71	17.15	5.49	17.37	638.88	3.25	415.5
root-CK-high-11406	UAUUAUAAGACGUUUUGACU	2.68	0	2.2	2.35	5.96	46.69	1.63	33.66
root-CK-high-12952	UUAACGUUUGACCACUCGUCUU	1.15	0	0	0	0.25	2.9	0	0
root-CK-high-1309	UAAACAUGUUUGACCGUUCGUC	1.15	0	0.22	0.59	0.5	5.01	0	0
root-CK-high-13603	UUCAUGUUGAUGUUAGUAGAUU	5.36	0.24	3.3	2.55	1.74	17.15	0	0
root-CK-high-2334	UUGUUGCUACCUUCCAUGCAGA	2.49	0.24	0.22	1.18	0.25	0	0	7.19
root-CK-high-2928	UUCUAGCAUUUCCCACAUUCA	1.34	0	0	0.39	0.25	0	0	10.54
root-CK-high-4603	UGACAGAAGAGAGUGAGCA	1.15	0	0	0	9.68	36.14	275.46	87.88
root-CK-high-4920	UCUUGACCUUGUAAGACCCAA	7.28	0.24	1.1	0.78	3.72	28.22	0	0
root-CK-high-5263	AACUGGUACGGACAAGGGG	2.68	0.24	1.1	2.94	0.99	0	88.57	0
root-CK-high-5965	UGCCUGGCUCCCUGUAUGC	1.34	0	0.66	0.2	0.25	0	0	7.71
root-CK-high-6739	UUUGGCUUGCAACGUUUGACC	28.91	2.61	3.52	2.16	7.2	165.65	86.13	130.28
root-CK-high-7883	UUGCAGGUCCGUUGGAUUGGA	1.53	0	1.54	0.59	1.74	3.17	0	11.82
shoot-As-high-16223	UUUUCACUAAAAAAUAGUCGGC	0.77	0	0	1.96	0.5	2.64	0	0
shoot-As-high-2209	GGAUGUUUUCAUUAAUCAA	2.11	0.48	0.88	38.62	0.99	0	42.25	0
shoot-As-high-850	UAGGUGAACCUGCGGAAGGA	0	0	0	1.57	0.5	0	0	2.83
shoot-As-high-9528	UUGAGCCGUGCCAAUAUCACG	1.34	0.71	0.66	7.25	43.18	32.18	0.81	453.27
shoot-CK-high-1260	CGGACCAGGCUUCAUUCCUC	0.38	0.24	1.32	0	0	0.26	0	14.39
shoot-CK-high-1263	CGGACCAGGCUUCAUUCCCC	81.17	47.99	15.83	0	0.5	8.7	0	5.14
shoot-CK-high-2001	CCACAGGCUUUCUUGAACUG	1.72	0.48	11.43	0	10.67	501.45	456.66	279.57
shoot-CK-high-2855	UGCACUGCCUCUUCCCUGGC	0	0	1.1	0	2.23	32.71	91.82	74.26
shoot-CK-high-3401	GAAGCUGCCAGCAUGAUCUGA	7.66	3.8	23.09	0.2	9.18	13.98	0	91.48
shoot-CK-high-38	GAUUGAGCCGUGCCAAUAUC	6.51	6.65	1.54	0	2.98	0	0	10.02
shoot-CK-high-5721	UUGGAUUGAAGGGAGCUCUG	9.19	1.66	30.34	2.74	69.49	5479.54	9979.95	7642.19
shoot-CK-high-6015	AACUGGAAUAAAAGAAUUA	0	0	1.1	0	17.87	0	94.26	11.56
shoot-CK-high-7069	CGCUUGGUGCAGAUCGGGAC	18.38	6.65	26.6	1.18	1.49	4.75	0	0
shoot-CK-high-7529	GUUGUCUCAAGCUUGCUGCC	3.45	1.19	2.86	0.2	1.49	0	119.45	0
shoot-CK-high-7947	UUCCACAGGCUUUCUUGAACUG	0.96	0.24	1.98	0	1.24	134.79	40.63	12.33
root-As-high-992	CGGCAAGUGAUGUGAACAUU	0	2.38	1.54	0	0	3.96	0	0
shoot-CK-high-1707

Note: ¹Expression levels in roots under mock treatment. ²Expression levels in roots under arsenic (As) treatment. ³Expression levels in shoots under mock treatment. ⁴Expression levels in shoots under arsenic treatment. ⁵Control for “AGO1a”, “AGO1b” and “AGO1c”. ⁶Accumulation levels in AGO1a. ⁷Accumulation levels in AGO1b. ⁸Accumulation levels in AGO1c. All of the expression levels were calculated in RPM (reads per million).