Table 3.
List of arsenic-responsive small RNAs targeting long non-coding RNAs in rice.
| Small RNA IDs | Small RNA sequences | CK_root1 | As_root2 | CK_shoot3 | As_shoot4 | Control5 | AGO1a6 | AGO1b7 | AGO1c8 |
|---|---|---|---|---|---|---|---|---|---|
| root-CK-high-10130 | UAUGACGCUGUUGACUUUUAG | 3.25 | 0 | 1.1 | 1.18 | 8.69 | 141.39 | 2.44 | 32.38 |
| root-CK-high-1309 | UAAACAUGUUUGACCGUUCGUC | 1.15 | 0 | 0.22 | 0.59 | 0.5 | 5.01 | 0 | 0 |
| root-CK-high-13603 | UUCAUGUUGAUGUUAGUAGAUU | 5.36 | 0.24 | 3.3 | 2.55 | 1.74 | 17.15 | 0 | 0 |
| root-CK-high-2928 | UUCUAGCAUUUCCCACAUUCA | 1.34 | 0 | 0 | 0.39 | 0.25 | 0 | 0 | 10.54 |
| root-CK-high-4417 | UUAAAUAUGUUUGACCGUUCG | 1.34 | 0 | 0 | 0.39 | 1.49 | 5.8 | 0 | 0 |
| root-CK-high-4603 | UGACAGAAGAGAGUGAGCA | 1.15 | 0 | 0 | 0 | 9.68 | 36.14 | 275.46 | 87.88 |
| shoot-As-high-14 | AUUAAGCCAUGCAUGUGCAAG | 1.53 | 1.19 | 0 | 1.37 | 0.5 | 0 | 30.88 | 0 |
| shoot-As-high-17275 | UGUGAGAAAAAGUCAACGGCG | 0 | 0.48 | 0 | 1.18 | 9.68 | 24 | 56.07 | 70.92 |
| shoot-As-high-2209 | GGAUGUUUUCAUUAAUCAA | 2.11 | 0.48 | 0.88 | 38.62 | 0.99 | 0 | 42.25 | 0 |
Note: 1Expression levels in roots under mock treatment. 2Expression levels in roots under arsenic (As) treatment. 3Expression levels in shoots under mock treatment. 4Expression levels in shoots under arsenic treatment. 5Control for “AGO1a”, “AGO1b” and “AGO1c”. 6Accumulation levels in AGO1a. 7Accumulation levels in AGO1b. 8Accumulation levels in AGO1c. All of the expression levels were calculated in RPM (reads per million).