Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus, 129/SvJ/C57BL/6J) | SLC48A1, HMOX1 | This paper, Materials and methods subsection animals | Mouse strain | |
| Biological sample (Mus musculus) | Primary bone marrow-derived macrophages | SLC48A1/HMOX1 mice | ||
| Biological sample (Plasmodium falciparum) | Hemozoin | Plasmodium falciparum | Gift from Dr. Paul Sigala | |
| Antibody | SLC48A1 (Rabbit, polyclonal) | PMID: 30248094 | 1:500 | |
| Antibody | F4/80 (Rat, polyclonal) | Invitrogen | MF48000 RRID:AB_10376289 |
1:1000 |
| Antibody | HMOX1 (rabbit, polyclonal) | Enzo | ADI-SPA-896 RRID:AB_10614948 |
1:1000 |
| Antibody | LAMP1 (rat, polyclonal) | Developmental Studies Hybridoma Bank | 1D4B RRID:AB_2134500 |
1:100 |
| Antibody | Anti-F4/80 microbeads | Miltenyi Biotech | 130-110-443 | Beads |
| Recombinant DNA reagent | guide RNA | Sage Laboratories | TAGGGACGGTGGTCTACCGACAACCGG | |
| Recombinant DNA reagent | Cas9 RNA | Trilink Biotechnologies | ||
| Sequence-based reagent | HMOX1 KO F | PMID: 24963040 | GCTTGGGTGGAGAGGCTATTC | |
| Sequence-based reagent | HMOX1 KO R | PMID: 24963040 | CAAGGTGAGATGACAGGAGATC | |
| Sequence-based reagent | HMOX1 WT F | PMID: 24963040 | GTACACTGACTGTGGGTGGGGGAG | |
| Sequence-based reagent | HMOX1 WT R | PMID: 24963040 | AGGGCCGAGTAGATATGGTAC | |
| Sequence-based reagent | Custom qPCR array | Qiagen; this paper | CLAM25204D | |
| Commercial assay or kit | Stanbio Iron and TIBC kit | VWR | 10152–550 | |
| Commercial assay or kit | mouse ferritin ELISA kit | Abcam | ab157713 | |
| Commercial assay or kit | LDH kit | Sigma | TOX7 | |
| Commercial assay or kit | ROS kit | Sigma | MAK142 | |
| Commercial assay or kit | GSH assay kit | Abcam | ab138881 | |
| Chemical compound, drug | Clodronate liposomes | Clodronate liposomes | C-005 | |
| Software, algorithm | Heatmapper software | PMID: 27190236 | ||
| Software, algorithm | PRISM seven software | Graphpad | ||
| Other | 59FeCl3 | Perkin Elmer | NEZ037001MC | Radioactive material |