Skip to main content
. 2019 Oct 1;8:e49503. doi: 10.7554/eLife.49503

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Strain, strain background (Mus musculus, 129/SvJ/C57BL/6J) SLC48A1, HMOX1 This paper, Materials and methods subsection animals Mouse strain
Biological sample (Mus musculus) Primary bone marrow-derived macrophages SLC48A1/HMOX1 mice
Biological sample (Plasmodium falciparum) Hemozoin Plasmodium falciparum Gift from Dr. Paul Sigala
Antibody SLC48A1 (Rabbit, polyclonal) PMID: 30248094 1:500
Antibody F4/80 (Rat, polyclonal) Invitrogen MF48000
RRID:AB_10376289
1:1000
Antibody HMOX1 (rabbit, polyclonal) Enzo ADI-SPA-896
RRID:AB_10614948
1:1000
Antibody LAMP1 (rat, polyclonal) Developmental Studies Hybridoma Bank 1D4B
RRID:AB_2134500
1:100
Antibody Anti-F4/80 microbeads Miltenyi Biotech 130-110-443 Beads
Recombinant DNA reagent guide RNA Sage Laboratories TAGGGACGGTGGTCTACCGACAACCGG
Recombinant DNA reagent Cas9 RNA Trilink Biotechnologies
Sequence-based reagent HMOX1 KO F PMID: 24963040 GCTTGGGTGGAGAGGCTATTC
Sequence-based reagent HMOX1 KO R PMID: 24963040 CAAGGTGAGATGACAGGAGATC
Sequence-based reagent HMOX1 WT F PMID: 24963040 GTACACTGACTGTGGGTGGGGGAG
Sequence-based reagent HMOX1 WT R PMID: 24963040 AGGGCCGAGTAGATATGGTAC
Sequence-based reagent Custom qPCR array Qiagen; this paper CLAM25204D
Commercial assay or kit Stanbio Iron and TIBC kit VWR 10152–550
Commercial assay or kit mouse ferritin ELISA kit Abcam ab157713
Commercial assay or kit LDH kit Sigma TOX7
Commercial assay or kit ROS kit Sigma MAK142
Commercial assay or kit GSH assay kit Abcam ab138881
Chemical compound, drug Clodronate liposomes Clodronate liposomes C-005
Software, algorithm Heatmapper software PMID: 27190236
Software, algorithm PRISM seven software Graphpad
Other 59FeCl3 Perkin Elmer NEZ037001MC Radioactive material