Table 6:
Novel variants
| A: CDS | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Closest allele | Feature name | Ref | Con | Start | End | Effect | IPD-IMGT/HLA 3.35.0 | Ethnicity | Parent |
| A*32:01:01 | Exon1 | T | A | 66 | 67 | Non-synonymous TGG (W) -> AGG (R) |
A*32:106 | AFA | 1 |
| DPA1*02:02:01 | Exon 3 | G | A | 17 | 18 | Non-synonymous GTG (V) -> ATG (M) |
DPA1*02:07:01:01 | ASI EUR HIS |
12 |
| A | G | 127 | 128 | Synonymous | |||||
| A | G | 208 | 209 | Synonymous | |||||
| DPA1*03:01 | Exon 4 | G | C | 76 | 77 | Synonymous | DPA1*03:01:02 | AFA | 1 |
| DPA1*04:01 | Exon 4 | G | A | 32 | 33 | Non-synonymous GCG (A) -> ACG (T) |
DPA1*04:02 | AFA | 2 |
| DQB1*05:01:01:01 | Exon 1 | C | T | 80 | 81 | Synonymous | DQB1*05:01:024:01 | ASI | 3 |
| DQB1*06:02:01 | Exon 3 | C | T | 238 | 239 | Synonymous | DQB1*06:02:27 | AFA | 1 |
| DPA1*01:03:01:02 | Exon 4 | C | G | 76 | 77 | Synonymous | Novel | HIS | 1 |
| DPA1*02:02:02 | Exon 4 | C | G | 46 | 47 | Synonymous | Novel | ASI | 2 |
| B: UTRs and Introns | |||||||||
| Closest allele | Feature name | Ref | Con | Start | End | IPD-IMGT/HLA 3.35.0 | Ethnicity | Parent | |
| DQB1*03:01:01:03 | Intron 2 | C | T | 429 | 430 | DQB1*03:01:01:04 | Other | 1 | |
| DQB1*03:01:01:01 | Intron 3 | G | T | 479 | 480 | DQB1*03:01:01:05 | EUR/HIS | 6 | |
| DQB1*03:01:01:01 | Intron 2 | AAATTTATGATTAATCAATC | - | 1430 | 1450 | DQB1*03:01:01:06 | EUR/HIS | 12 | |
| DQB1*03:01:01:01 | Intron 1 | G | T | 1380 | 1381 | DQB1*03:01:01:07 | ASI | 8 | |
| Intron 2 | G | A | 1533 | 1534 | |||||
| DQB1*03:01:01:03 | Intron 1 | T | C | 632 | 633 | ||||
| Intron 1 | G | T | 1380 | 1381 | |||||
| DQB1*03:01:01:01 | Intron 1 | G | T | 1380 | 1381 | DQB1*03:01:01:12 | ASI | 3 | |
| Intron 2 | G | A | 1141 | 1142 | |||||
| Intron 2 | G | A | 1533 | 1534 | |||||
| DQB1*03:01:01:03 | Intron 1 | T | C | 632 | 633 | ||||
| Intron 1 | G | T | 1380 | 1381 | |||||
| Intron 2 | G | A | 1141 | 1142 | |||||
| DPA1*02:01:01:02 | Intron 1 | C | T | 601 | 602 | DPA1*02:01:01:07 | ASI | 1 | |
| DQA1*04:01:01 | Intron 1 | G | A | 1163 | 1164 | Novel | EUR/HIS | 27 | |
| DQB1*03:01:01:03 | Intron 2 | T | C | 1390 | 1391 | Novel | HIS | 1 | |
| DQB1*03:01:01:03 | Intron 3 | C | A | 86 | 87 | Novel | ASI | 1 | |
| 5’ UTR | C | T | 484 | 485 | |||||
Table 6 shows novel variants identified in CDS (A) and UTR/introns (B). The column “Closest allele” shows allele name in IPD-IMGT/HLA Database release version 3.25.0. The novel variants were identified comparing consensus sequences against reference DNA sequences in IPD-IMGT/HLA Database 3.25.0. Prefix HLA- is removed for the allele name. HLA-DPA1*02:02:01 existed in IPD-IMGT/HLA Database version 3.25.0, but was eliminated after IPD-IMGT/HLA Database release version 3.26.0. The “Feature name” column shows where the novel variants were identified. The “Ref” column indicates reference sequence/nucleotide, and the “Con” column indicates the consensus sequence/nucleotide. The “Start” and “End” columns indicate the nucleotide positions represented using zero-based coordinates for each reference feature. The “Effect” column in Table 6A indicates whether the novel variants are Synonymous or Non-synonymous against the reference allele. Allele names using IPD-IMGT/HLA Database 3.35.0 database corresponding to these variations are shown in the “IPD-IMGT/HLA 3.35.0” column if identified. “Novel” indicates that the variants are not included in IPD-IMGT/HLA Database version 3.35.0. The “Ethnicity” column shows the broad continental groups in which the specific variations were identified, and the “Parent” column shows the number of parents that carried the variation. HLA-DQB1*03:01:01:07 and HLA-DQB1*03:01:01:12 were originally assigned as HLA-DQB1*03:01:01:01 or HLA-DQB1*03:01:01:03, respectively, because they had equal number of mismatches; they were equally possible closest alleles (Figure 2B).