Key resources table.
| Reagent type (species) or resource |
Designation |
Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | Wild-type C57BL/6J | The Jackson Laboratory | #000664; RRID:IMSR_JAX:000664 | |
| Genetic reagent (Mus musculus) | KrasG12D | PMID:15093544 | MGI:2429948 | |
| Genetic reagent (Mus musculus) | Alb-cre | PMID:9867845 | MGI:2176228 | |
| Cell line (Homo sapiens) | Primary human skin fibroblasts | Coriell Cell Repositories | Cat. # GM00730; RRID:CVCL_L944 | |
| Cell line (Homo sapiens) | HuH-7 | Japanese Collection of Research Bioresources Cell Bank | Cat. # JCRB0403; RRID:CVCL_0336 | |
| Cell line (Homo sapiens) | 293T | American Type Culture Collection | Cat. # CRL-3216; RRID:CVCL_0063 | |
| Cell line (Mus musculus) | KrasG12DHCC cell line | PMID:30643286 | Laboratory of Davide Ruggero (UCSF) | |
| Antibody | RAS (rabbit polyclonal) | Cell Signaling Technology | Cat. #3965; RRID:AB_2180216 | (1:1000) |
| Antibody | PTEN (rabbit monoclonal) | Cell Signaling Technology | Cat. #9188; RRID:AB_2253290 | (1:1000) |
| Antibody | β-actin (mouse monoclonal) | Sigma-Aldrich | Cat. # A5316; RRID:AB_476743 | (1:10,000) |
| Antibody | p21 (mouse monoclonal) | BD Biosciences | Cat. # 556431 (clone SXM30); RRID:AB_396415 | (1:50) |
| Antibody | NRAS (mouse monoclonal) | Santa Cruz Biotechnology | Cat. # sc-31 (clone F155); RRID:AB_628041 | (1:50) |
| Recombinant DNA reagent | NRASG12V | Addgene, PMID:19147555 | Plasmid #20205; RRID:Addgene_20205 | (pT/Caggs-NRASV12) |
| Recombinant DNA reagent | SB13 | Addgene, PMID:19147555 | Plasmid #20207; RRID:Addgene_20207 | (PT2/C-Luc//PGK-SB13) |
| Recombinant DNA reagent | HRASG12V | Addgene | Plasmid #9051; RRID:Addgene_9051 | (pBABE puro H-Ras V12) |
| Recombinant DNA reagent | PTEN shRNA | PMID:29720449 | (pLKO.1-PTEN-shRNA) Laboratory of Davide Ruggero (UCSF) |
|
| Recombinant DNA reagent | Rluc-Fluc control | PMID:30576652 | (pCMV-WT: CMV promoter, Rluc-Fluc) Laboratory of Maria Barna (Stanford University) |
|
| Recombinant DNA reagent | CGC codon 245 | Other | (pCMV-245 CGC: CMV promoter, Rluc-Fluc) Laboratory of Maria Barna (Stanford University) |
|
| Recombinant DNA reagent | AAU codon 529 | This paper | Generated by site-directed mutagenesis of plasmid pCMV-WT at codon 529 from AAA to AAT (pCMV-529 AAU) | |
| Recombinant DNA reagent | Readthrough control | PMID:22099312 | (pJD175f (pHDL-SV40-control)) Laboratory of Jonathan Dinman (University of Maryland) |
|
| Recombinant DNA reagent | UAG stop codon | Other | (pJD1644 (pHDL-SV40-UAG)) Laboratory of Jonathan Dinman (University of Maryland) |
|
| Recombinant DNA reagent | UGA stop codon | Other | (pJD1645 (pHDL-SV40-UGA)) Laboratory of Jonathan Dinman (University of Maryland) |
|
| Sequence-based reagent | Oligonucleotides for qPCR analysis | This paper | Supplementary file 2 | |
| Sequence-based reagent | Synthetic mRNA Met-Phe | Dharmacon | CAACCUAAAACUUACACACCCUUAGAGGGACAAUCGAUGUUCAAAGUCUUCAAAGUCAUC | |
| Sequence-based reagent | Synthetic mRNA Met-Lys | Dharmacon | CAACCUAAAACUUACACACCCUUAGAGGGACAAUCGAUGAAAUUCGUCUUCAAAGUCAUC | |
| Commercial assay or kit | Dual-Luciferase Reporter Assay System | Promega | Cat. # E1910 | |
| Commercial assay or kit | Senescence Detection Kit | Calbiochem-Millipore | Cat. # QIA117 | |
| Commercial assay or kit | CellTiter-Glo Luminescent Cell Viability Assay | Promega | Cat. # G7570 | |
| Chemical compound, drug | Anisomycin | Sigma-Aldrich | Cat. # A9789 | |
| Chemical compound, drug | Paromomycin | Sigma-Aldrich | Cat. # P9297 | |
| Chemical compound, drug | Cycloheximide | Sigma-Aldrich | Cat. # C7698 | |
| Chemical compound, drug | O-propargyl-puromycin | Medchem Source LLP | Cat. # JA-1024 | |
| Chemical compound, drug | Cy3-Maleimide | GE Healthcare | Cat. # PA23031 | |
| Chemical compound, drug | LD655-NHS | Lumidyne Technologies | Cat. # 08 | |
| Chemical compound, drug | LD650-NHS | Lumidyne Technologies | Cat. # 99 | |
| Software, algorithm | PyMOL | Schrödinger, NY, USA | https://www.pymol.org/2/ | |
| Software, algorithm | ImageJ | National Institute of Health, USA | https://imagej.nih.gov/ij/ | |
| Software, algorithm | GraphPad Prism six software | GraphPad | https://www.graphpad.com/ | |
| Software, algorithm | Spartan | Other | Available at: https://www.scottcblanchardlab.com/software |