Table 5.

Potential miRNA-mRNA interactions involved in atropine-treated corneal epithelial cells.

	Predicted Consequential Pairing of Target Region (Top) and miRNA (Bottom)	Context++ Score	Context++ Score Percentile	Weighted Context++ Score	miRDB
Position 1034–1040 of EPHA7 3′ UTR miR-651-3p	5′  … UGCAGACAUCCUCCAUUUCCUUU…                | | | | | | |  3′      GAAAAUCCUAUGUGAAAGGAAA	−0.02	37	0.00	97
Position 3122–3128 of EPHA7 3′ UTR miR-651-3p	5′  …AUAGUAUUCUUCCUGUUUCCUUU…                | | | | | | |  3′      GAAAAUCCUAUGUGAAAGGAAA	−0.02	37	0.00	97
Position 1932-1938 of TMEM108 3′ UTR miR-3148	5′  …CACUUUAGGCCACAG - - UUUUUCCU…           | | |       | | | | | | |  3′        UUCGUGUGUGGUCAAAAAAGGU	−0.02	38	−0.02	99
Position 204-210 of TBX6 3′ UTR miR-874-5p	5′  …UGCUGGGAGUCCAGCUGGGGCCG…                | | | | | | |  3′      AGAAUGGGACCACGCACCCCGGC	−0.10	57	−0.10	94
Position 269-276 of TBX6 3′ UTR miR-874-5p	5′  …CUCUGCCUGGCCAAAUGGGGCCA…      | | | | |        | | | | | | |  3′  AGAAUGGGACCACGC - ACCCCGGC	−0.47	98	−0.47	94