Table 1.

Primers and cycling conditions used for the amplification of carbapenemase genes and the repetitive intergenic consensus

Primer	Sequence	Gene	Reference	Amplification conditions	Amplicon size (bp)
ERIC-1R	R:AACCCACGATGTGGGTAGC	-	50	Initial denaturation at 95oC for 15 min, then 35 cycles of 95oC for 1 min, 40oC for 1min and 72oC for 5 minutes and one cycle of final elongation at 72oC.	-
IPM	F: GGAATAGRRTGGCTTAAYT R: GGTTTAAYAAARCAMCCACC	blaIPM	51	Initial denaturation at 95oC for 15 min, then 35 cycles of 95oC for 1 min, 40oC for 1min and 72oC for 5 minutes and one cycle of final elongation at 72oC.	233
KPC	F: GTATCGCCGTCTAGTTCTGC R: GGTCGTGTTTCCCTTTAGCC	blaKPC	52	Initial denaturation at 95oC for 15 min, then 30 cycles of 95oC for 1 min, 55oC for 1min and 72oC for 5 minutes and one cycle of final elongation at 72oC.	637
NDM	F: GGTTTGGCGATCTGGTTTTC R: CGGAATGGCTCATCACGATC	blaNDM	53	Initial denaturation at 95oC for 15 min, then 30 cycles of 95oC for 1 min, 66.7oC for 1min and 72oC for 5 minutes and one cycle of final elongation at 72oC.	621
VIM	F: GTTTGGTCGCATATCGCAAC R: GAGCAAKTCYAGACCGCCC	blaVIM	51	Initial denaturation at 95oC for 15 min, then 30 cycles of 95oC for 1 min, 63oC for 1min and 72oC for 5 minutes and one cycle of final elongation at 72oC.	591
OXA-23	F: GATCGGATTGGAGAACCAGA R: ATTTCTGACCGCATTTCCAT	blaOXA-23	54	Initial denaturation at 95oC for 15 min, then 30 cycles of 95oC for 1 min, 66.7oC for 1min and 72oC for 5 minutes and one cycle of final elongation at 72oC.	501
OXA-40	F: GGTTAGTTGGCCCCCTTAAA R: AGTTGAGCGAAAAGGGGATT	blaOXA-40	55	Initial denaturation at 95oC for 15 min, then 30 cycles of 95oC for 1 min, 66.6oC for 1min and 72oC for 5 minutes and one cycle of final elongation at 72oC.	249
OXA-48	F: GCTTGATCGCCCTCGATT R: GATTTGCTCCGTGGCCGAAA	blaOXA-48	56	Initial denaturation at 95oC for 15 min, then 30 cycles of 95oC for 1 min, 60.5oC for 1min and 72oC for 5 minutes and one cycle of final elongation at 72oC.	281
OXA-51	F: TAATGCTTTGATCGGCCTTG R: TGGATTGCACTTCATCTTGG	blaOXA-51	57	Initial denaturation at 95oC for 15 min, then 30 cycles of 95oC for 1 min, 60.5oC for 1min and 72oC for 5 minutes and one cycle of final elongation at 72 oC.	353
OXA-58	F: AAGTATTGGGGCTTGTGCTG R: CCCCTCTGCGCTCTACATAC	blaOXA-58	54	Initial denaturation at 95oC for 15 min, then 30 cycles of 95oC for 1 min, 60.5oC for 1min and 72oC for 5 minutes and one cycle of final elongation at 72oC.	599
OXA-181	F: ATGCGTGTATTAGCCTTATCG R: AACTACAAGCGCATCGAGCA	blaOXA-181	22	Initial denaturation at 95oC for 15 min, then 30 cycles of 95oC for 1 min, 55oC for 1min and 72oC for 5 minutes and one cycle of final elongation at 72oC.	888

Notes: R= (A⁄G), Y= (C⁄ T), K= (G⁄ T) and M= (A⁄C). Boldface in this  table clarifies primers and different stages of the PCR cycles.