KEY RESOURCE TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit Polyclonal anti-Twist2 | Abcam | ab66031 |
| Rabbit Polyclonal anti-Sema3a | Abcam | ab23393 |
| Rabbit Monoclonal anti-Nrp1 | Abcam | ab81321 |
| Mouse Monoclonal anti-Myh4 | Invitrogen | 14–6503-82 |
| Mouse Monoclonal anti-Myh2 | DSHB | SC-71 |
| Mouse Monoclonal anti-Myh4 | DHSB | BF-F3 |
| Mouse Monoclonal anti-Myh7 | Sigma-Aldrich | NOQ7.5D |
| Mouse Monoclonal anti-myosin skeletal, fast (MY32) | Sigma-Aldrich | M4276 |
| WGA-Alexa Fluor 555 | Life Technologies | W32464 |
| WGA-Alexa Fluor 647 | Life Technologies | W32466 |
| Mouse Monoclonal anti-GAPDH | Millipore | CB1001 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Recombinant Sema3a-Fc | R&D Systems | 5926-S3–025 |
| Recombinant Fc Fragments | Invitrogen | 31205 |
| Matrigel | Corning | 356234 |
| Critical Commercial Assays | ||
| iScript Reverse Transcriptase Supermix | Bio-Rad | 1708840 |
| Nrp1 Taqman Probe | Applied Biosciences | Mm00435379_m1 |
| KAPA SYBR Fast ABI Prism | KAPA Biosciences | 07959435001 |
| Deposited Data | ||
| RNA-Sequencing of isolated Tw2+ and Pax7+ cells | Liu et al. 2017 | GSE84377, GSE84378, GSE84379, and GSE 84380. |
| RNA-Sequencing of Twist2-overexpressing myoblasts vs GFP-expressing myoblasts | Liu et al. 2017 | GSE84377, GSE84378, GSE84379, and GSE 84380. |
| Twist2 ChIP-Sequencing | Li et al. 2019 | GSE127998 |
| Experimental Models: Cell Lines | ||
| Twist2-derived myoblasts | Liu et al. 2017 | N/A |
| Pax7-derived myoblasts | Liu et al. 2017 | N/A |
| Primary myoblasts | This Paper | N/A |
| Experimental Models: Organisms/Strains | ||
| Mck-Sema3a transgenic mice | This paper | N/A |
| Tw2-CreERT2; R26-tdTomato | Liu et al. 2017 | N/A |
| Mck-Sema3a; Tw2-CreERT2; R26-tdTomato | This paper | N/A |
| Oligonucleotides | ||
| Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC | This paper | N/A |
| Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC | This paper | N/A |
| Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT | This paper | |
| Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT | This paper | |
| Recombinant DNA | ||
| pBabe-Nrp1 | This paper | N/A |
| pBabe-Sema3a-EGFP | This paper | N/A |
| shNrp1 #1–4 | Origene | TG513573A |
| pLentiV2-sgNrp1 #1–8 | This paper | N/A |
| psPax2 | Addgene; http://n2t.net/addgene:12260 | 12260 |
| pMD2.G | Addgene; http://n2t.net/addgene:12259 | 12259 |
| pCRII-TOPO | ThermoFisher | 45-0640 |
| pBabe-EGFP | Addgene; Parker et al. 2012 | 36999 |
| Software and Algorithms | ||
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| GraphPad Prism 8 | GraphPadSoftware | https://www.graphpad.com/scientific-software/prism/ |
| Other | ||
| Silicon Matrix | Martin Bastmeyer, Karlsruhe Institute of Technology | https://znbio.zoo.kit.edu/Mitarbeiter_66.php |