Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (C. elegans) | WT | CGC | N2, RRID:WB-STRAIN:N2_(ancestral) | |
| Strain, strain background (C. elegans) | Cec-4 deletion | CGC | RB2301, RRID:WB-STRAIN:RB2301 | |
| Strain, strain background (C. elegans) | CEC4-mCherry transgene | Gonzalez-Sandoval et al. (2015) | GW849 | |
| Strain, strain background (C. elegans) | Cec-4 rescue with Cec-4-mCherry transgene | This paper | ||
| Cell line (D. melanogaster) | S2 | Maya Capelson lab | CVCL_TZ72, RRID:CVCL_TZ72 | Late embryonic stage cells |
| Cell line (Xenopus laevis) | S3 | Matthew Good lab | CVCL_GY00, RRID:CVCL_GY00 | Embryonic cells |
| Cell line (Mus musculus) | C2C12 | ATCC | CRL-1772, RRID:CVCL_0188 | C2C12 skeletal myoblast |
| Cell line (Mus musculus) | NIH/3T3 | ATCC | CRL-1658, RRID:CVCL_0594 | NIH/3T3 fibroblasts |
| Cell line (Mus musculus) | mESC | ATCC | CRL-1934, RRID:CVCL_4378 | Embryonic stem cells |
| Cell line (Homo-sapiens) | HeLa | ATCC | CCL-2, RRID:CVCL_0030 | |
| Cell line (Homo-sapiens) | IMR-90 | ATCC | CCL-186, RRID:CVCL_0347 | IMR-90 fibroblasts |
| Cell line (Homo-sapiens) | hESC | Rajan Jain lab | RRID:CVCL_EL23 | Induced pluripotent stem cells |
| Antibody | anti-H3K9me2 (Rabbit polyclonal) | Active Motif | Cat# 39239, RRID:AB_2793199 | IF (1:1000), WB (1:3000) |
| Antibody | anti-H3K9me2 (Rabbit polyclonal) | Active Motif | Cat# 39375, RRID:AB_2793234 | IF (1:1000) |
| Antibody | anti-H3K9me2 (Mouse monoclonal) | Abcam | Cat# ab1220, RRID:AB_449854 | IF (1:1000), WB (1:3000) |
| Antibody | Mouse anti-H3K9me2S10p | Active Motif | Cat# 61429, RRID:AB_2793632 | IF (1:1000) |
| Antibody | anti-H3K9me3 (Rabbit polyclonal) | Abcam | Cat# ab8898, RRID:AB_306848 | IF (1:1000) |
| Antibody | anti-H3K27me3 (Rabbit polyclonal) | EMD Millipore | Cat# 07–499, RRID:AB_310624 | IF (1:1000) |
| Antibody | anti-Lamin B1 (Rabbit polyclonal) | Abcam | Cat# ab16048, RRID:AB_10107828 | IF (1:1000) |
| Antibody | Goat anti-Lamin B (Goat polyclonal) | Santa Cruz | Cat# sc-6216, RRID:AB_648156 | IF (1:1000) |
| Antibody | Goat anti-Lamin B (Goat polyclonal) | Santa Cruz | Cat# sc-6217, RRID:AB_648158 | IF (1:1000) |
| Antibody | anti-Lamin A/C (Mouse monoclonal) |
Santa Cruz | Cat# sc-376248, RRID:AB_10991536 | IF (1:1000) |
| Antibody | anti-LMN1 (Mouse monoclonal) | Developmental Studies Hybridoma Bank | Cat# LMN1, RRID:AB_10573809 | IF (1:1000) |
| Antibody | anti-histone H3 (Rabbit polyclonal) | Abcam | Cat# ab1791, RRID:AB_302613 | IF (1:1000) |
| Antibody | anti-GFP (Rabbit polyclonal) | Abcam | Cat# ab290, RRID:AB_303395 | IF (1:1000) |
| Antibody | anti-Rabbit AlexaFluor 555 (Donkey polyclonal) | Invitrogen | Cat# A31572, RRID:AB_162543 | IF (1:1000) |
| Antibody | anti-Rabbit AlexaFluor 488 (Donkey polyclonal) | Invitrogen | Cat# A21206, RRID:AB_2535792 | IF (1:1000) |
| Antibody | anti-Rabbit AlexaFluor 568 (Donkey polyclonal) | Invitrogen | Cat# A10042, RRID:AB_2534017 | IF (1:1000) |
| Antibody | anti-Rabbit AlexaFluor 647 (Donkey polyclonal) | Invitrogen | Cat# A31573, RRID:AB_2536183 | IF (1:1000) |
| Antibody | anti-Mouse AlexaFluor 488 (Donkey polyclonal) | Invitrogen | Cat# A21202, RRID:AB_141607 | IF (1:1000) |
| Antibody | anti-Mouse AlexaFluor 568 (Donkey polyclonal) | Invitrogen | Cat# A10037, RRID:AB_2534013 | IF (1:1000) |
| Antibody | anti-Goat AlexaFluor 488 (Donkey polyclonal) |
Invitrogen | Cat# A11055, RRID:AB_2534102 | IF (1:1000) |
| Antibody | anti-Goat AlexaFluor 568 (Donkey polyclonal) | Invitrogen | Cat# A11057, RRID:AB_2534104 | IF (1:1000) |
| Antibody | anti-Goat AlexaFluor 647 (Donkey polyclonal) |
Invitrogen | Cat# A21447, RRID:AB_2535864 | IF (1:1000) |
| Antibody | anti-Rabbit IgG, HRP-linked | Cell Signaling | Cat# 7074, RRID:AB_2099233 | WB (1:7500) |
| Antibody | anti-Mouse IgG, HRP-linked | Cell Signaling | Cat# 7076, RRID:AB_330924 | WB (1:7500) |
| Peptide array | MODified Histone Peptide Array | Active Motif | Cat# 13001 | |
| Peptide | H3K9me2 | Abcam | Cat# ab1772 | IF (1:500) |
| Peptide | H3K9me3 | Abcam | Cat# ab1773 | IF (1:500) |
| Peptide | H3K27me2 | Abcam | Cat# ab1781 | IF (1:500) |
| Peptide | H4K20me2 | Abcam | Cat# ab14964 | IF (1:500) |
| Peptide | H3K9me0 | EpiCypher | Cat# 12–0001 | IF (1:500) |
| Peptide | H3K9me1 | EpiCypher | Cat# 12–0010 | IF (1:500) |
| Peptide | H3K9me2 | EpiCypher | Cat# 12–0011 | IF (1:500) |
| Peptide | H3K9me3 | EpiCypher | Cat# 12–0012 | IF (1:500) |
| Peptide | H3K9me2S10p | EpiCypher | Cat# 12–0093 | IF (1:500) |
| Peptide | H3S10p | EpiCypher | Cat# 12–0041 | IF (1:500) |
| Recombinant DNA reagent | mEmerald-H3-23 (plasmid) | Addgene | Cat# 54115,RRID:Addgene_54115 | Histone H3 mEmerald-tag, deposited by Michael Davidson |
| Recombinant DNA reagent | H3 K9A (plasmid) | This paper | Histone H3 with K9A substitution | |
| Recombinant DNA reagent | H3 K9E (plasmid) | This paper | Histone H3 with K9E substitution | |
| Recombinant DNA reagent | H3 S10A (plasmid) | This paper | Histone H3 with S10A substitution | |
| Recombinant DNA reagent | H3 S10E (plasmid) | This paper | Histone H3 with S10E substitution | |
| Sequence-based reagent | H3 K9A forward | This paper | PCR primers | ACTAAACAGACAGCTCGGGCATCCACCGGCGGTAAAGCG |
| Sequence-based reagent | H3 K9A reverse | This paper | PCR primers | CGCTTTACCGCCGGTGGATGCCCGAGCTGTCTGTTTAGT |
| Sequence-based reagent | H3 K9E forward | This paper | PCR primers | ACTAAACAGACAGCTCGGGAATCCACCGGCGGTAAAGCG |
| Sequence-based reagent | H3 K9E reverse | This paper | PCR primers | CGCTTTACCGCCGGTGGATTCCCGAGCTGTCTGTTTAGT |
| Sequence-based reagent | H3 S10A forward | This paper | PCR primers | ACTAAACAGACAGCTCGGAAAGCCACCGGCGGTAAAGCG |
| Sequence-based reagent | H3 S10A reverse | This paper | PCR primers | CGCTTTACCGCCGGTGGCTTTCCGAGCTGTCTGTTTAGT |
| Sequence-based reagent | H3 S10E forward | This paper | PCR primers | ACTAAACAGACAGCTCGGAAAGAAACCGGCGGTAAAGCG |
| Sequence-based reagent | H3 S10E reverse | This paper | PCR primers | CGCTTTACCGCCGGTTTCTTTCCGAGCTGTCTGTTTAGT |
| Commercial assay or kit | QuikChange II XL Site-Directed Mutagenesis Kit | Agilent technologies | Cat# 200521 | |
| Software, algorithm | Imaris 9.0.1 | Bitplane | RRID:SCR_007370 | http://www.bitplane.com/imaris/imaris |
| Software, algorithm | Image J | National Institute of Health | RRID:SCR_003070 | https://imagej.net/ |
| Software, algorithm | Vutara SRX | Bruker Corporation | https://www.bruker.com/products/fluorescence-microscopes/vutara-super-resolution-microscopy/overview/srx-software-vutara-super-resolution.html | |
| Software, algorithm | GraphPad Prism 8 | GraphPad Software | RRID:SCR_002798 | http://www.graphpad.com/ |