Table 3. Oligonucleotide primers and probe of citrus tatter leaf virus detection assay designed in this study.
| Primers/probes* | Sequence 5'- 3' | Nucleotide Position1 |
Amplicon size (bp) |
|---|---|---|---|
| CTLV 6315 F1 | CGAGGCAGGTTCGGAGAGTA | 6315–6334 | 82 |
| CTLV 6316 F2 | GAGGCGGGTTCGGAGAGTA | 6316–6334 | |
| CTLV 6315 F3 | TGAGGCAGGTTCGGAGAGTAA | 6315–6335 | |
| CTLV R | CCTGCAAGACCGCGACC | 6380–6396 | |
| CTLV 6338 P FAM | TGGAACTGGAGGGTTAG | 6338–6354 |
1Nucleotide position is based on reference genome of citrus tatter leaf virus isolate TL100 (NCBI GenBank Accession No. MH108975).
*F: forward primer. R: Reverse primer. P: qPCR probe.