Intracellular bacterial infections affect all vertebrates. Cultured fish are particularly vulnerable because no effective protection measures have been established since such infections emerged approximately 50 years ago. As in other vertebrates, the induction of cell-mediated immunity (CMI) plays an important role in protecting fish against infection. However, details of the mechanism of CMI induction in fish have not been clarified.
KEYWORDS: cell-mediated immunity, fish pathogens, interleukin 12, intracellular bacteria
ABSTRACT
Intracellular bacterial infections affect all vertebrates. Cultured fish are particularly vulnerable because no effective protection measures have been established since such infections emerged approximately 50 years ago. As in other vertebrates, the induction of cell-mediated immunity (CMI) plays an important role in protecting fish against infection. However, details of the mechanism of CMI induction in fish have not been clarified. In the present study, we focused on the production of interleukin 12 (IL-12), an important factor in CMI induction in fish. Using several different approaches, we investigated IL-12 regulation in amberjack (Seriola dumerili), the species most vulnerable to intracellular bacterial disease. The results of promoter assays and transcription factor gene expression analyses showed that the expression of interferon regulatory factor-1 (IRF-1) and activator protein-1 (AP-1) is necessary for IL-12 production. Phagocytosis of living cells (LCs) of Nocardia seriolae bacteria induced IL-12 production in neutrophils, accompanied by IRF-1 and AP-1 gene expression. Bacteria in which the exported repetitive protein (Erp)-like gene was deleted (Δerp-L) could not establish intracellular parasitism or induce IRF-1 and AP-1 expression or IL-12 production, despite being phagocytosed by neutrophils. These data suggest that IL-12 production is regulated by (i) two transcription factors, IRF-1 and AP-1, (ii) phagocytosis of LCs by neutrophils, and (iii) one or more cell components of LCs. Our results enhance the understanding of the immune response to intracellular bacterial infections in vertebrates and could facilitate the discovery of new agents to prevent intracellular bacterial disease.
INTRODUCTION
Epidemic tuberculosis remains one of the top 10 causes of death worldwide (1). Tuberculosis is caused by an intracellular bacterial pathogen that employs a variety of mechanisms to survive in host cells (e.g., arrest of phagolysosome formation by Mycobacterium tuberculosis [2–5], escape from phagosomes by M. tuberculosis [2, 6, 7] and Listeria monocytogenes [2, 8, 9], and reprogramming of phagosome maturation by Legionella pneumophila [2, 10–12]). Such bacterial persistence can lead to chronic, latent, or low-grade infections in the host (13–15). A variety of chemical agents have been developed to treat persistent bacterial infections in mammals. In the case of bacterial infections recalcitrant to chemical treatment, however, vaccines are often employed as a preventive measure. Live-attenuated vaccines, such as the bacillus Calmette-Guérin (Mycobacterium bovis BCG) vaccine, are often effective against these diseases. In some cases, approved inactivated vaccines exhibit poor efficacy (16, 17) because they do not induce strong cell-mediated immunity (CMI), which directly kills infected cells (18–20), even though they induce antibody production by the humoral immune system.
Teleost fishes are also affected by persistent diseases caused by intracellular bacteria, and this can result in significant economic losses in the aquaculture industry. Mycobacteriosis and nocardiosis, diseases caused by Mycobacterium species and Nocardia seriolae, respectively, affect a variety of fish species (21–28). CMI-inducing vaccines, such as the BCG vaccine, and antigen-encoding DNA vaccines or recombinant subunit vaccines are effective against these diseases in Japanese flounder (Paralichthys olivaceus) (21, 22), hybrid striped bass (Morone chrysops × Morone saxatilis) (23), amberjack (Seriola dumerili) (24–27), and largemouth bass (Micropterus salmoides) (28). However, the mechanisms by which these vaccines function have yet to be elucidated.
Recent research has demonstrated that interleukin 12 (IL-12) plays an important role in the induction of CMI in fish. IL-12-mediated induction of the differentiation of naive helper T cells (Th0) into Th1 cells is necessary for the activation of CMI (26, 29). IL-12 (also known as IL-12p70) is composed of an alpha chain (p35a) and a beta chain (p40), and it is produced by antigen-presenting cells, such as macrophages or dendritic cells (30, 31). To date, two IL-12p35 genes (p35a and p35b genes) and three IL-12p40 genes (p40a, p40b, and p40c genes) have been identified in various fish species. In rainbow trout (Oncorhynchus mykiss) and amberjack, leukocytes stimulated with recombinant IL-12p70 induce the expression of CMI-related genes in vitro (32, 33). Our previous study showed that the survival rate after N. seriolae bacterial challenge of amberjack vaccinated with formalin-killed N. seriolae cells (FKCs) supplemented with recombinant IL-12p70 as an adjuvant was significantly higher than that of fish vaccinated with FKCs alone, probably due to CMI induced by IL-12p70 (34). Available data suggest that IL-12p70 plays an important role in the activation of CMI in fish. However, the mechanisms controlling the expression of IL-12p70 have not been elucidated. Determining how IL-12p70 production is regulated would enhance the understanding of CMI against infections with intracellular bacteria in other vertebrate hosts, which in turn could facilitate the development of new and more effective preventive agents.
In the present study, we investigated the mechanism of IL-12p70 production in amberjack using several different approaches. The expression of candidate transcription factors thought to be involved in controlling IL-12p70 production was examined using promoter assays. The pattern of transcription factor gene expression in relation to IL-12p70 production in leukocytes in response to stimulation with N. seriolae bacterial FKCs or living cells (LCs) was examined. Next, we identified the primary IL-12-producing leukocyte populations by comparing the responses to LC stimulation. We also examined the effect of phagocytosis on transcription factor gene expression and IL-12p70 production in neutrophils. Finally, IL-12 production by neutrophils infected with N. seriolae LCs was investigated by comparing the responses to those of neutrophils challenged with N. seriolae LCs in which the exported repetitive protein (Erp)-like gene was deleted, rendering the mutant incapable of intracellular parasitism due to changes in bacterial cell wall components.
RESULTS
Luminescence of goldfish scale fibroblast cells (GAKS cells) transfected with the amberjack IL-12p35a gene promoter.
Candidate transcription factors associated with control of amberjack IL-12p35a gene expression were investigated using a promoter assay (Fig. 1). The predicted transcription initiation site (TATA box) was located 82 bp upstream from the IL-12p35a gene translation initiation site (Fig. S3 in the supplemental material). Predicted binding sites for the transcription factors that likely control IL-12p35a gene expression were located within a region extending 1,000 bp upstream from the TATA box (Fig. S3). This region included binding sites for transcription factors related to the expression of the mammalian IL-12 gene, i.e., activator protein-1 (AP-1), interferon regulatory factor element (IRF-E), and NF-κB, which were located 898, 132, and 101 bp upstream from the TATA box, respectively (Fig. S3). The promoter assay result indicated no significant changes among all groups with the addition of medium only and lipopolysaccharide (LPS) stimulation. In contrast, a significant reduction in signal transduction was observed in both ΔAP-1ΔIRF-E- and ΔAP-1ΔIRF-EΔNF-κB-transfected cells compared to the signal transduction in wild-type and ΔAP-1 cells following stimulation with recombinant ginbuna interferon gamma isoform 1-1 (rgIFN-γ1-1) (P < 0.005) (Fig. 1). Transcription factor activation by each stimulus (LPS and rgIFN-γ1-1) was confirmed by electrophoretic mobility shift assay (EMSA) (Fig. S4).
FIG 1.
Transcription factors predicted to control IL-12p35a gene expression, as determined using a promoter assay. Preincubated GAKS cells cotransfected with expression and control plasmids were stimulated with medium only, LPS, or rgIFN-γ1-1 for 6 h. Data represent mean values ± SE from five independent experiments after normalization for transfection efficiency. Luciferase activity is reported as fold difference from induction in GAKS cells stimulated with medium only. Asterisks indicate significant differences (*, P < 0.05, one-way ANOVA followed by Tukey’s post hoc test). RLU, relative light units.
IL-12p70 production and expression of transcription factor genes in spleen leukocytes stimulated with N. seriolae FKCs or LCs.
IL-12p70 production by amberjack leukocytes in response to FKC or LC stimulation was investigated by enzyme-linked immunosorbent assay (ELISA) (Fig. 2A). With FKC stimulation, significant differences were observed after 12 and 24 h compared with the IL-12p70 production in leukocytes stimulated with medium only (P < 0.001 and P = 0.004, respectively). Furthermore, with LC stimulation, significant increases in IL-12p70 production were observed after 12 and 24 h compared with the level in leukocytes stimulated with either medium only (P < 0.001 and P < 0.001, respectively) or FKCs (P < 0.001 and P < 0.001, respectively). We then examined the expression of transcription factor genes (AP-1, IRF-1, and NF-κB genes) following stimulation with N. seriolae FKCs or LCs (Fig. 2B to L). We first examined the expression of AP-1 genes (c-Fos1, c-Fos2, c-Fos3, c-Jun1, and c-Jun2 genes) (Fig. 2B to F). With FKC stimulation, the expression of the c-Fos2 gene was significantly upregulated after 24 h compared with its expression in cells stimulated with medium only (P < 0.001) (Fig. 2C). In addition, the expression of the c-Jun1 gene was relatively high after 12 and 24 h compared with its expression in leukocytes stimulated with medium only (P = 0.039 and P = 0.011, respectively) (Fig. 2E). In contrast, with LC stimulation, the expression of both the c-Fos1 gene and the c-Fos2 gene was upregulated after 24 h compared with the expression in leukocytes stimulated with either medium only (P < 0.001 and P = 0.004, respectively) or FKCs (P < 0.001 and P = 0.001, respectively) (Fig. 2B and C). The expression of both the c-Fos2 gene and the c-Jun2 gene was upregulated after 6 h compared with the expression in leukocytes stimulated with medium only (P = 0.004 and P = 0.005, respectively) or FKCs (P = 0.015 and P = 0.013, respectively) (Fig. 2C and F). The c-Fos2 gene exhibited the highest expression at all time points under all stimulation conditions (Fig. 2C), whereas no changes were observed in c-Fos3 gene expression up to 24 h under any of the stimulation conditions (Fig. 2D). Subsequently, the pattern of IRF-1 gene expression was examined (Fig. 2G). Following FKC stimulation, IRF-1 gene expression did not differ significantly from that of leukocytes stimulated with medium only or LCs within 24 h. In contrast, following LC stimulation, IRF-1 gene expression was upregulated at 6 h (although not significantly); at 24 h, its expression was significantly upregulated compared with that of leukocytes stimulated with medium only (P = 0.041). In this experiment, the expression of NF-κB-related genes (RelA, RelB, c-Rel, p100, and p105 genes) was not significantly affected under any stimulation condition (Fig. 2H to L). However, the expression of RelB, p100, and p105 genes was relatively higher in leukocytes stimulated with LCs than in cells stimulated under the other conditions (Fig. 2I, K, and L).
FIG 2.
IL-12 production and transcription factor gene expression in amberjack leukocytes stimulated with N. seriolae FKCs or LCs, measured using ELISA (A) and real-time PCR analysis (B to L). (A) Isolated amberjack leukocytes (1 × 107) were stimulated with medium only, 1 × 107 CFU of N. seriolae FKCs, or N. seriolae LCs. (B to L) Real-time PCR analysis of amberjack spleen leukocytes showing mRNA expression of AP-1-related genes, including c-Fos1 (B), c-Fos2 (C), c-Fos3 (D), c-Jun1 (E), and c-Jun2 (F) genes, the IRF-1 gene (G), and NF-κB-related genes, including RelA (H), RelB (I), c-Rel (J), p100 (K), and p105 (L) genes. Isolated leukocytes were stimulated with medium only, 1 × 107 CFU of N. seriolae FKCs, or N. seriolae LCs. Expression level of each of the above-mentioned genes in each group is presented as the ratio of its expression to that of the EF-1α gene. Fold change in expression of each gene was calculated based on its expression in cells stimulated for 6 h with medium only (n = 4). Asterisks indicate significant differences (*, P < 0.05, and **, P < 0.01, one-way ANOVA followed by Tukey’s post hoc test).
Expression of the IL-12p35a gene in leukocyte subpopulations.
The composition of amberjack leukocyte subpopulations was examined using flow cytometry (FCM). Lymphocytes, macrophages, and neutrophils constituted the majority of leukocytes (40, 6, and 20%, respectively) (Fig. 3A and B). The expression of the IL-12p35a gene was examined in each subpopulation after stimulation with N. seriolae LCs (Fig. 3C). Among the three major leukocyte subpopulations, neutrophils exhibited the highest IL-12p35a gene expression (P = 0.004).
FIG 3.
(A and B) Isolation and identification of amberjack leukocyte populations using flow cytometry (A) and May-Grunwald-Giemsa staining (B). SS, side scatter; FS, forward scatter; Lin, linear amplification. (B) Arrowheads indicate representative cell morphology in each fraction. Images were acquired at 2,000 × magnification. (C) Each isolated amberjack cell was cultured with N. seriolae. Real-time PCR analysis of cells showing mRNA expression of IL-12p35a. Expression levels of IL-12p35a are presented as the ratio of expression to that of the EF-1a gene. Fold change in expression of genes was calculated based on expression in cells stimulated with medium only (n = 4). An asterisk indicates a significant difference (*, P < 0.05).
Comparison of IL-12p70 production and expression of IL-12p35a gene and transcription factor genes in neutrophils containing phagocytosed LCs and nonphagocytosing neutrophils.
The effect of cytochalasin D treatment on the expression of the IL-12 gene and various transcription factor genes (data not shown) was examined in a preliminary experiment (Fig. S5). SYBR gold-positive cells constituted approximately 4.2% of all neutrophils (1 × 105) following treatment with cytochalasin D and approximately 28.0% of control neutrophils not treated with cytochalasin D (P < 0.001) (Fig. 4A), indicating that cytochalasin D inhibits the phagocytosis of LCs by neutrophils. In neutrophils treated with cytochalasin D, both IL-12p70 production and IL-12p35a gene expression were significantly lower than in control cells (without cytochalasin D) (P = 0.015 and P = 0.041, respectively) (Fig. 4B and C). Analysis of the expression of various transcription factor genes (AP-1-related c-Fos2 and c-Jun2 genes, IRF-1 gene, and NF-κB-related RelB and p100 genes) (Fig. 4D to H) showed dramatic downregulation of c-Jun2 and IRF-1 gene expression with cytochalasin D treatment, whereas c-Fos2 gene expression was not affected (P < 0.001) (Fig. 4D to F). In addition, cytochalasin D had no effect on the expression of the NF-κB-related RelB and p100 genes (Fig. 4G and H).
FIG 4.
Effect of phagocytosis on IL-12 production. Isolated neutrophils (1 × 106) were preincubated with or without cytochalasin D for 6 h. Preincubated neutrophils were cocultured with SYBR gold-labeled N. seriolae LCs (1 × 107 CFU). (A and B) The numbers of SYBR gold-positive (SYBR Gold+) neutrophils were determined using flow cytometry (A), and the concentrations of IL-12 in culture supernatants were determined by ELISA (B). Data represent mean values ± SE from four independent experiments. Asterisks indicate significant differences (*, P < 0.05, and **, P < 0.01, Student’s t test). (C to H) Expression of IL-12p35a gene (C), AP-1-related genes, including c-Fos2 (D) and c-Jun2 (E) genes, the IRF-1 gene (F), and NF-κB-related genes, including RelB (G) and p100 (H) genes, in cultured cells was examined using real-time PCR analysis. Expression level of each of the above-mentioned genes in each group is presented as the ratio of its expression to that of the EF-1α gene. Fold change in expression of each gene was calculated based on its expression in cells stimulated with medium only (n = 4). Asterisks indicate significant differences (*, P < 0.05, and **, P < 0.01, Student’s t test).
IL-12p70 production and expression of IL-12p35a gene and transcription factor genes in neutrophils stimulated with N. seriolae FKCs, LCs, or Δerp-L mutant cells.
The results of analysis of the phagocytic activity of neutrophils stimulated with N. seriolae FKCs, LCs, or Δerp-L mutant cells are shown in Fig. 5. Characteristics of N. seriolae Δerp-L mutant cells are shown in Fig. S6 and S7. In neutrophils stimulated with FKCs, SYBR gold-positive cells constituted 36.8% of all neutrophils (1 × 105), which was not significantly different from the results of LC stimulation (Fig. 5A). SYBR gold-positive cells constituted 38.0% of neutrophils stimulated with Δerp-L mutant cells, similar to the results for neutrophils stimulated with FKCs or LCs (Fig. 5A). Investigation of IL-12p70 production and IL-12p35a gene expression (Fig. 5B and C) showed that the concentration of IL-12p70 produced by neutrophils stimulated with FKCs was significantly lower than that of cells stimulated with LCs (P = 0.014) (Fig. 5B). A significant difference was also observed following stimulation with Δerp-L mutant cells compared with LC stimulation (P = 0.006), whereas no significant difference was observed compared with FKC stimulation (Fig. 5B). Furthermore, the expression of the IL-12p35a gene in neutrophils stimulated with Δerp-L mutant cells was significantly downregulated compared with its expression in neutrophils stimulated with LCs, whereas no significant difference was observed compared with FKC stimulation (P = 0.015) (Fig. 5C). Finally, the expression of the AP-1-related, IRF-1, and NF-κB-related genes (Fig. 5D to H) showed that FKC stimulation induced significant downregulation in the expression of AP-1-related genes (c-Fos2 and c-Jun2 genes) and the expression of the IRF-1 gene compared with the results of LC stimulation (P < 0.001, P < 0.001, and P = 0.001, respectively). These genes were also significantly downregulated in neutrophils stimulated with Δerp-L mutant cells compared with their expression in LC-stimulated neutrophils (P = 0.003, P < 0.001, and P = 0.023, respectively), whereas no significant difference was observed compared with the results of FKC stimulation (Fig. 5D to F). Furthermore, the expression of NF-κB-related genes (RelB and p100 genes) was not altered (Fig. 5G and H).
FIG 5.
Comparison of IL-12 production by neutrophils stimulated with N. seriolae LCs, FKCs, and Δerp-L mutant cells. Isolated neutrophils (1 × 106) were stimulated with 1 × 107 CFU of SYBR gold-labeled N. seriolae LCs, FKCs, or Δerp-L mutant cells. (A and B) The numbers of SYBR gold-positive neutrophils were determined by flow cytometry (A), and the concentrations of IL-12 in culture supernatants were determined by ELISA (B). Data represent the mean values ± SE from four independent experiments. Asterisks indicate significant differences (*, P < 0.05, one-way ANOVA followed by Tukey’s post hoc test). (C to G) Expression of the IL-12p35a gene (C), AP-1-related genes, including c-Fos2 (D) and c-Jun2 (E) genes, the IRF-1 gene (F), and NF-κB-related genes, including RelB (G) and p100 (H) genes, in cultured cells was examined by real-time PCR analysis. Expression level of each of these genes in each group is presented as the ratio of its expression to that of the EF-1α gene. Fold change in expression of each gene was calculated based on its expression in cells stimulated with medium only (n = 4). Asterisks indicate significant differences (*, P < 0.05, one-way ANOVA followed by Tukey’s post hoc test).
DISCUSSION
In this study, we clarified the mechanism of IL-12 production for the first time in fish. IL-12p70 production in amberjack involves the following: (i) regulation by two transcription factors, IRF-1 and AP-1, (ii) phagocytosis of N. seriolae LCs by neutrophils, and (iii) stimulation with an outer bacterial-cell component, such as a cell wall component or lipids, which are lost upon erp gene deletion. Live-attenuated vaccines or DNA vaccines that induce strong CMI in the host cannot be applied to cultured fish in some countries, and live-attenuated-bacterium strains of some fish disease pathogens, such as Mycobacterium fortuitum, Mycobacterium chelonae, Mycobacterium shotti, and N. seriolae, have not yet been established. Therefore, a strategy for inducing CMI in fish by means other than such vaccines is needed. The results of the present study illustrate a potential novel strategy for protecting fish from intracellular bacterial disease and could prove useful for other vertebrate species as well.
In European seabass (Dicentrarchus labrax) and pufferfish (Takifugu rubripes), the IL-12p35 gene promoter contains a transcription initiation site (TATA box), and the expression of this gene is regulated by stimulation with LPS, IFN-γ, or both (35, 36). In the present study, a TATA box was also found in the amberjack IL-12p35a gene promoter region, and signal transduction was affected by rgIFN-γ1-1 stimulation, suggesting that IL-12p70 production in amberjack is controlled by IL-12p35 gene expression. Furthermore, promoter assay results suggested that IRF-1 activation following rgIFN-γ1-1 stimulation plays an important role in controlling IL-12p35a gene expression in amberjack. In human macrophages, IL-12p70 functions in an autocrine pathway induced by IRF-1 activation via IFN-γ (37). Expression in cyprinid fish demonstrated that the signaling cascade via IFN-γ is conserved between fish and mammals (38, 39), suggesting that IFN-γ-mediated activation of IRF-1 induces IL-12p35a gene expression in amberjack.
Stimulation with bacterial FKCs and LCs has been shown to elicit different immune responses in a variety of species. For example, high antibody titers are induced in fish after injection with FKCs, but such high antibody titers were not produced by LC injection in fish (40). In this study, we found that FKCs downregulated IL-12p70 production to a greater extent than LCs in leukocytes. In addition, transcription factor gene expression analyses showed that the expression of AP-1-related (c-Fos2 and c-Jun2 genes) and IRF-1-related genes is activated by LC stimulation but not FKC stimulation. In mice, IRF-1 induces IL-12p70 production along with activation of other transcription factors (e.g., NF-κB activator 1 [Act-1] [41] and signal transducer and activator of transcription 1 [STAT1] [42]). Thus, IRF-1, as well as AP-1, would be expected to induce IL-12p70 production in amberjack.
In mice, neutrophils can serve as a source of IL-12, an important early cytokine source for inducing CMI and driving macrophage activation, without IFN-γ stimulation (43). Some researchers suggest that neutrophils are unable to kill M. tuberculosis by phagocytosis directly, and thus, they hypothesize that neutrophils could mediate immunomodulation indirectly through the production of cytokines or secretion of granule that can activate infected macrophages (44, 45). In the case of amberjack, IL-12 expression in neutrophils is higher than that of other leukocytes (macrophages and lymphocytes), suggesting that neutrophils play an important role early in intracellular bacterial infection in both fish and mammals. The present study showed that IL-12p70 production and transcription factor gene expression in amberjack neutrophils are induced by phagocytosis of LCs. This is consistent with a previous report showing that human monocytes produce IL-12p40 following phagocytosis of M. tuberculosis antigens (46). The importance of phagocytosis as a signal for IL-12 production in humans has been demonstrated by three lines of evidence: (i) stimulation with particles with unique surface characteristics (bacteria lacking LPS, bacteria expressing an LPS analogue, and polystyrene beads) induces IL-12p40 gene expression, (ii) intact, nonviable Mycobacteria induce IL-12p40 gene expression but fragments of Mycobacteria do not, and (iii) cytochalasin D downregulates IL-12p40 gene expression (46). These data indicate that phagocytosis plays a more important role than antigen contact in IL-12 production in amberjack. However, IL-12p70 production and transcription factor gene expression were not induced by phagocytosis of FKCs. Thus, we hypothesized that only live bacteria induce IL-12p70 production, and we compared the responses of neutrophils that phagocytosed FKCs or Δerp-L mutant cells. Erp is a secretory protein that mediates virulence in M. tuberculosis (47, 48), and it is required for intracellular growth and survival due to its role in maintaining the cell wall and outer lipid layer (49, 50). In the present study, IL-12p70 production in neutrophils stimulated with Δerp-L mutant cells was almost the same as that of neutrophils stimulated with FKCs even though phagocytosis was equivalent. Consequently, one or more components of the cell wall or lipid layer of N. seriolae affected by the deletion of erp-L play a critical role in IL-12 production. In mammals, the bacterial cell wall glycolipids trehalose dimycolate and glucose monomycolate induce the expression of various host inflammatory and Th1-related cytokines, including IL-12p70 (51, 52). Thin-layer chromatography (TLC) analyses in the present study indicated that the glycolipids of N. seriolae Δerp-L mutant cells differ from those of LCs (Fig. S8 in the supplemental material). It has also been reported that glycolipids isolated from N. seriolae induce the expression of CMI-related genes in ginbuna crucian carp, although receptors of these glycolipids are lost in the fish genome (26). Thus, at the least, the presence of glycolipids on the surface of intracellular bacterial pathogens would induce transcription factor (IRF-1 and AP-1) gene expression, followed by IL-12p70 production.
To summarize the results of the present study, IL-12 production in amberjack is regulated as follows. First, antigen is phagocytosed by neutrophils regardless of the cell surface structural characteristics. Second, phagocytic signals induce activation of the transcription factors IRF-1 and AP-1. Third, these activated transcription factors induce IFN-γ and IL-12 production, which in turn induces potent IL-12p35 production via a positive feedback loop. These data suggest that N. seriolae glycolipids play an important role in IRF-1 and AP-1 activation through phagocytosis-associated signaling. Further clarification of the relationship between immune response mechanisms in fish and bacterial lipids could facilitate the development of strategies to protect other vertebrate species from intracellular bacterial infections.
MATERIALS AND METHODS
Animals.
Artificially hatched amberjack juveniles weighing 50 to 60 g were maintained in a 1-m3, fiber-reinforced plastic tank with running seawater at 25 to 28°C at the Kagoshima Prefectural Fisheries Technology and Development Center (Ibusuki, Japan). Fish were fed commercial pellets on a daily basis at 2% body weight. BALB/c mice were purchased from CLEA Japan. All experiments were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Kagoshima University.
Bacteria.
Nocardia seriolae strain 024013, isolated from yellowtail, was cultured on brain heart infusion agar (BHIA; BD, Franklin Lakes, NJ, USA) plates. To prepare FKCs, 5% formaldehyde in phosphate-buffered saline (PBS; Nacalai Tesque, Japan) was added to a 5-day bacterial culture. After incubation for 2 additional days at 4°C, the bacteria were pelleted by centrifugation at 500 × g for 10 min and then washed three times with PBS. Adjusted FKCs and LCs cultured for 5 days were used for in vitro experiments.
Cell culture.
Myeloma cells for the production of amberjack IL-12 monoclonal antibody were cultured in RPMI 1640 medium (Wako, Japan) containing 200 mM l-glutamine (Nacalai Tesque) and 10% fetal bovine serum (FBS; Sigma-Aldrich, St. Louis, MO, USA) at 37°C with 5% CO2. Hybridomas fused with myeloma cells and mouse leukocytes were cultured in RPMI 1640 medium containing 200 mM l-glutamine, 20% FBS, and 5% BriClone (KAC Co., Ltd., Japan) at 37°C with 5% CO2. After 24 h, HAT supplement (Thermo Fisher Scientific, Waltham, MA, USA) was added to eliminate unfused or self-fused myeloma cells. Goldfish scale fibroblast cells (GAKS cells) used for promoter analyses were cultured with Dulbecco’s modified Eagle’s medium (Wako) containing 10% FBS at 37°C with 5% CO2. Amberjack leukocytes isolated as described below were cultured at 25°C in RPMI 1640 medium containing 200 mM l-glutamine, 1% penicillin-streptomycin solution (Wako), and 5% FBS. Amberjack neutrophils sorted as described below were cultured at 25°C in RPMI 1640 medium containing 200 mM l-glutamine, 1% penicillin-streptomycin solution, 20% FBS, and 1% amberjack serum.
Preparation of amberjack IL-12p70 monoclonal antibody.
A monoclonal antibody to recombinant amberjack IL-12p35a/p40a (raIL-12p70) was produced as follows. raIL-12p70 was purified as described previously (32). Endotoxin was removed from the purified recombinant protein using polymyxin B sulfate (Thermo Fisher Scientific) according to the manufacturer’s instructions. raIL-12p70 (100 μg/ml), emulsified in TiterMax gold complete Freund’s adjuvant (CFA; TiterMax, USA), was injected into the footpads of BALB/c mice. Boost immunizations were conducted by injecting 50 μg/ml of raIL-12p70 into the thigh 1 month after the first immunization. Twenty-four hours after the boost immunization, spleen lymphocytes were fused with P3-X63.Ag8.653 myeloma cells, which were kindly provided by the Cell Resource Center for Biomedical Research of Tohoku University (Miyagi, Japan). Reactions between 1E8 and raIL-12p70 were examined by Western blotting and flow cytometry (FCM) analyses (Fig. S1 in the supplemental material), and the antibody was then used in further analyses.
Preparation of N. seriolae with deletion of the exported repetitive protein-like gene (Δerp-L strain) by homologous recombination.
The exported repetitive protein-like (erp-L) gene of N. seriolae strain 024013 was cloned using the genome sequence of N. seriolae strain 2927 as a reference (Fig. S2). DNA fragments of regions upstream and downstream from erp-L (600 bp each) were amplified using specific primer sets containing SphI and XbaI recognition sites and fused using overlapping sites (Table S1). The PCR product was cloned into the gene disruption vector pK18mobsac B, containing a cefotaxime (CTX) resistance site, which was kindly provided by the National Institute of Genetics (Shizuoka, Japan). N. seriolae 024013 cells were transformed with the gene disruption vector using an ECM630 electroporation system (BMBio, Japan) at 2.5 kV, 25 μF, and 1,000 Ω in 1-mm-gap electroporation cuvettes (BMBio). Transformed N. seriolae cells were cultured in both BHIA containing 1% CTX (BHIA–1% CTX; Wako) and BHIA containing 10% sucrose (BHIA–10% suc). Cells of N. seriolae that were CTX resistant and sucrose sensitive were chosen as a single recombinant strain. After that, selected cells were transferred to BHI broth without CTX and cultured at 25°C with shaking at 180 rpm for 5 days to allow a second recombination event to remove the plasmid. Several bacterial colonies were then picked and transferred to BHIA–1% CTX and BHIA–10% suc. Cells that were CTX sensitive and sucrose resistant were chosen as a double recombinant strain. Deletion of the erp-L gene was confirmed by PCR (Table S1).
Promoter assay and gel EMSA.
The upstream region (about 1,000 bp) of the amberjack IL-12p35a gene was amplified by PCR using a specific primer set (Table 1). The transcription factor recognition sequence was predicted as described by Nascimento et al. (35), using TFBIND (http://tfbind.hgc.jp/). The four PCR products (designated wild type, ΔAP-1, ΔAP-1ΔIRF-E, and ΔAP-1ΔIRF-EΔNF-κB) were amplified using specific primer sets containing KpnI or HindIII recognition sites (Table 1) and cloned into the firefly luciferase expression vector pGL4.10[luc2] (Promega, USA). GAKS cells were cotransfected with the reporter plasmid and Renilla control vector pRL-SV40 (Promega) using FuGene HD transfection reagent (Promega) according to the manufacturer’s instructions and incubated for 24 h. After incubation, transfected cells were stimulated with 1 ng/ml of recombinant ginbuna IFN-γ1-1 (rgIFN-γ1-1) (kindly provided by the Department of Veterinary Medicine, Nihon University) or 100 μg/ml of lipopolysaccharide (LPS; Sigma-Aldrich) at 25°C for 6 h. Luminescence was measured on a Gene Light 55A luminometer (Microteq-Nichion, Japan) using a Dual-Luciferase reporter assay system (Promega) according to the manufacturer’s instructions.
TABLE 1.
PCR primers used to construct plasmids for promoter assay
| Primer | Sequence |
|---|---|
| IL-12p35a promoter full (FOR) | TCCTGTGATGGTACCCTGAAAGGAGG |
| IL-12p35a promoter full (REV) | CTTTCTTATCAAAGCTTGATCTTTGGTC |
| IL-12p35a promoter ΔAP-1 (FOR) | CTATTTCCCGGTACCTGCTGCTGCTG |
| IL-12p35a promoter ΔAP-1ΔIRF-1 (FOR) | TCCTGAAGGGGTACCGAATCCCCCGA |
For the EMSA, 1 × 106 GAKS cells were stimulated with rgIFN-γ1-1, LPS, or both for 6 h, and then the cells were pelleted by centrifugation at 500 × g for 5 min at 4°C and the supernatant removed. Nuclear extraction was performed according to the report of Schreiber et al. (53). Briefly, pelleted cells were treated with buffer A (10 mM HEPES-KOH [pH 7.9], 1.5 mM MgCl2, and 10 mM KCl) to isolate the nucleus. After incubation on ice for 20 min, cells were centrifuged at 500 × g for 10 s at 4°C, and the supernatant was then removed. Nucleoproteins were extracted by homogenization with buffer C (buffer A with 0.2 mM EDTA and 25% glycerol) and centrifuged at 500 × g for 2 min at 4°C after incubation for 20 min on ice, after which the supernatant was recovered. Extracted nucleoproteins (5 μg) were reacted for 20 min at 23°C with one of the biotin-labeled probes (5 μg) listed below and then annealed by incubation for 10 min at 94°C and cooled slowly at room temperature in binding buffer (75 mM Tris-HCl, 375 mM NaCl, 7.5 mM EDTA, 7.5 mM dithiothreitol [DTT], 35% glycerol, 1.5% Triton X-100, and 5 mg/ml bovine serum albumin [BSA]) and 1 mg/ml poly(dI-dC) (Thermo Fisher Scientific). The biotin-labeled probes were as follows: AP-1, sense, GAATCCTTTGAATTTAATACCACAAGTGAGTGACTGACCTACATATAGA, and antisense, TCTATATGTAGGTCAGTCACTCACTTGTGGTATTAAATTCAAAGGATTC; IRF-1, sense, AACGAGGAAATTACGTATGACGTTTTAGTTTTCTTTTTGCTCCTGAAG, and antisense, CTTCAGGAGCAAAAAGAAAACTAAAACGTCATACGTAATTTCCTCGTT; and NF-κB, sense, TTTTTGCTCCTGAAGGGGGAGGGAATCCCCCGAGAATGCATATAAATTC, and antisense, GAATTTATATGCATTCTCGGGGGATTCCCTCCCCTTCAGGAGCAAAAA. After incubation, proteins in each sample were separated on a 4% acrylamide gel by prerunning at 100 V for 90 min, followed by 150 V for 90 min. Proteins were then electroblotted onto a Whatman Nylon SPC membrane (GE Healthcare) for 60 min at 200 mA and cross-linked for 15 min using a UV transilluminator (ATTO, Japan). The membrane was blocked with 3% BSA in Tris-borate-EDTA (TBE) and treated with horseradish peroxidase (HRP)-avidin-biotin complex using a Vectastain elite ABC kit (Vector Laboratories, USA) according to the manufacturer’s instructions. Chemiluminescence was detected using Chemi-Touch (Bio-Rad, USA).
Analysis of gene expression in isolated amberjack leukocytes.
Analysis of gene expression in isolated amberjack leukocytes was performed as described previously (32). Briefly, the spleen was removed, disrupted using a 40-μm cell strainer (Corning, USA), and suspended in RPMI 1640 medium containing 5% FBS. The resulting cell suspension was applied to a Percoll gradient (1.040 and 1.070 g/ml) and centrifuged at 500 × g for 30 min. The fraction containing leucocytes was collected and washed three times with PBS. Isolated leukocytes were used for the extraction of total RNA using TRIzol reagent (Thermo Fisher Scientific), followed by cDNA synthesis using ReverTra Ace (Toyobo, Japan). Real-time PCR was performed using GoTaq quantitative PCR (qPCR) master mix (Promega, USA) and a MiniOpticon system (Bio-Rad) with the following specific primer sets: IL-12p35a (FOR) and (REV); c-fos1, c-fos2, c-fos3, c-jun1, and c-jun2 (FOR) and (REV) (for AP-1-related genes); IRF-1 (FOR) and (REV); RelA, RelB, c-Rel, p100, and p105 (FOR) and (REV) (for NF-κB-related genes); and EF-1α (FOR) and (REV) (Table 2).
TABLE 2.
PCR primers used for real-time PCR analysis
| Gene product | Primer | Sequence | Accession no. |
|---|---|---|---|
| IL-12p35a | IL-12p35a (FOR) | AGCCAAGTCCTCCATGATGTT | LC146386 |
| IL-12p35a (REV) | ATACATTACTGGCCTGCGCT | ||
| AP-1 | c-fos1 (FOR) | TGGATTCAGTCTCTCCCACCT | XM_022750896.1 |
| c-fos1 (REV) | AAATGGAGTGTCTTGAACGCT | ||
| c-fos2 (FOR) | GCAGGTGCAAACAAGGCGA | XM_022737860.1 | |
| c-fos2 (REV) | CTATCAGCTCCCTCCGTCTGTT | ||
| c-fos3 (FOR) | TGACCTGACAGCATCAAGTGC | XM_022768978.1 | |
| c-fos3 (REV) | GTGTAGGGGTGGGCTCTGT | ||
| c-jun1 (FOR) | TCCCTATTCAGGCACCGTTT | XM_022759272.1 | |
| c-jun1 (REV) | ACCCGTGCGATCATCAACAA | ||
| c-jun2 (FOR) | TCAGCACTCAACAATCGACC | XM_022755113.1 | |
| c-jun2 (REV) | GTGTTTCAGCGTTTTGGGGT | ||
| IRF-1 | IRF-1 (FOR) | TCAATTCCCTGGAAGCACGC | XM_022762303.1 |
| IRF-1 (REV) | CACGTCTTCGGGTCACTGTC | ||
| NF-κB | RelA (FOR) | AACAAAGAACGCACCGCAC | XM_022752201.1 |
| RelA (REV) | CACACTGTATGCCCAGGTTC | ||
| RelB (FOR) | TGGACATCGTCAGCCATCTTC | XM_022767565.1 | |
| RelB (REV) | AGCTGATTGCTCACTGTCCTC | ||
| c-Rel (FOR) | CCAGAGCGATCAACCCCTTC | XM_022743929.1 | |
| c-Rel (REV) | GTTGAGTGAGCGGGTGTAGT | ||
| p100 (FOR) | CACCTGGGAGAACGCCAC | XM_022748602.1 | |
| p100 (REV) | GCTCAGGTGCGTTGATCTTG | ||
| p105 (FOR) | GAACAGGAAGACCTACCCCAC | XM_022761336.1 | |
| p105 (REV) | GCGATGCAGATCCCTTTGTC | ||
| EF-1α | EF-1α (FOR) | TTCAACGCCCAGGTCATC | LC010974 |
| EF-1α (REV) | AACTTGCAGGCAATGTGAGC |
FCM analysis and cell sorting.
Subpopulations of isolated amberjack leukocytes were analyzed using an LC500 flow cytometer (Beckman Coulter, Brea, CA, USA). Each cell fraction was sorted using an SH800 cell sorter (Sony, Japan). Fractions developed by forward scatter/side scatter plots were sorted and centrifuged at 500 × g for 30 min. A portion of each cell sample collected was stained with May-Grunwald-Giemsa staining (Merck Millipore, Burlington, MA, USA) to confirm that sorting was conducted properly.
Analysis of phagocytic activity of amberjack neutrophils with and without cytochalasin D stimulated with N. seriolae FKCs, LCs, and Δerp-L mutant cells.
Amberjack neutrophils isolated as described above (1 × 106 cells) were incubated with 10 μg/ml of cytochalasin D (Wako) for 6 h to suppress phagocytic activity. N. seriolae LCs (1 × 107) stained with SYBR gold (Thermo Fisher Scientific) were added to preincubated neutrophils and incubated for 6 h. FKCs, LCs, and Δerp-L mutant cells of N. seriolae (1 × 107) stained with SYBR gold (Thermo Fisher Scientific) were added to neutrophils (without cytochalasin D) in 6 wells (2 wells for each cell) and incubated for 6 h. After incubation, neutrophils were centrifuged at 500 × g for 5 min and washed with PBS. Collected cells were fixed in 90% methanol for 10 min, and then the methanol was replaced with PBS. The cell suspension was examined by FCM, and the ratio of SYBR gold-positive cells per 1 × 105 cells was determined.
Analysis of gene expression in neutrophils stimulated with N. seriolae FKCs, LCs, and Δerp-L mutant cells.
Sorted neutrophils (1 × 106) were stimulated with N. seriolae FKCs, LCs, or Δerp-L mutant cells (1 × 107 CFU) with and without cytochalasin D for 6 h as described above. After stimulation, cells were centrifuged at 500 × g for 5 min, and real-time PCR was conducted as described above using specific primers (Table 2).
IL-12 enzyme-linked immunosorbent assay (ELISA).
Amberjack leukocytes (1 × 106) were stimulated with N. seriolae FKCs or LCs (1 × 107) for 6, 12, or 24 h. Isolated amberjack neutrophils (1 × 106) were stimulated with N. seriolae FKCs, LCs or Δerp-L mutant cells (1 × 107) for 6 h. Supernatants of stimulated cells were immobilized in wells of Nunc 96-well immune plates (Thermo Fisher Scientific) for 2 h at room temperature and then blocked with 1% skim milk containing PBS at 37°C for 2 h. After blocking, amberjack anti-IL-12p70 monoclonal antibody was added to each well (100 μg/well) and incubated for 1 h at room temperature. The secondary antibody reaction was conducted with HRP-conjugated anti-mouse IgG+IgM (1:2,000; Jackson ImmunoResearch, USA) under the same conditions as the primary antibody. A 3,3′-diaminobenzidine (DAB) kit for peroxidase (Nacalai Tesque) was used for detection according to the manufacturer’s instructions. Absorbance at 450 nm was measured using a Multiskan FC microplate reader (Thermo Fisher Scientific).
Glycolipid extraction and TLC.
Glycolipids isolated from N. seriolae FKCs, LCs, and Δerp-L mutant cells were prepared using chloroform/methanol (C/M) extraction. Bacteria (5 mg) were suspended in C/M (2:1, 1:1, and 1:2 [vol/vol] sequentially) and sonicated for 1 h. After sonication, the supernatant was collected by centrifugation at 1,500 × g for 10 min at 4°C and concentrated using an evaporator. Concentrated total lipids were dissolved in 5 ml of C/M (2:1 [vol/vol]), and 20 volumes of ice-cold acetone was added. After a 30-min incubation on ice, the suspension was centrifuged at 1,500 × g for 20 min at 4°C. The pellet was then dissolved in C/M (2:1 [vol/vol]), and the glycolipid composition was analyzed by TLC using silica gel HF Uniplates (Miles Scientific, Newark, DE) with a solvent system consisting of chloroform/methanol/acetone/acetic acid (90:10:10:1 [vol/vol]). After development, glycolipids were revealed by staining with orcinol sulfuric acid.
Histological analysis.
A total of 20 amberjack in each group were injected intraperitoneally with PBS (control), N. seriolae LCs, or Δerp-L mutant cells (1 × 103 CFU per fish) using a 23-gauge industrial syringe (Tsubasa Industry Co., Ltd., Japan). The kidneys and spleens were isolated from 5 amberjack in each group every 7 days (7, 14, 21, and 28 days after injection). The isolated tissues were fixed in Bouin’s solution and embedded in paraffin (Leica, Germany). Sections (5 μm) were stained with hematoxylin-eosin for microscopic observation.
Statistical analysis.
Results are expressed as the mean value ± standard error (SE). Expression and ELISA data were analyzed using one-way analysis of variance (ANOVA) followed by the Tukey post hoc test. Differences between the mean values of two groups were analyzed using Student’s t test. A P value of <0.05 was considered indicative of statistical significance.
Supplementary Material
ACKNOWLEDGMENTS
We thank Soetsu Yanagi and Kei Fukudome of the Kagoshima Prefectural Fisheries Technology and Development Center, Japan, for assistance with fish maintenance. We thank Satoshi Tasumi of Kagoshima University, Faculty of Fisheries, Japan, for assistance with writing the manuscript. We thank Teruyuki Nakanishi of Nihon University, Department of Veterinary Medicine, for providing the recombinant IFN-γ1-1 of ginbuna crucian carp.
This work was supported by JSPS KAKENHI through grant number 17J06515.
Footnotes
Supplemental material for this article may be found at https://doi.org/10.1128/IAI.00459-19.
REFERENCES
- 1.World Health Organization. 2018. Global tuberculosis report 2018. WHO, Geneva, Switzerland. [Google Scholar]
- 2.Flannagan RS, Cosío G, Grinstein S. 2009. Antimicrobial mechanisms of phagocytes and bacterial evasion strategies. Nat Rev Microbiol 7:355–366. doi: 10.1038/nrmicro2128. [DOI] [PubMed] [Google Scholar]
- 3.Pethe K, Swenson DL, Alonso S, Anderson J, Wang C, Russell DG. 2004. Isolation of Mycobacterium tuberculosis mutants defective in the arrest of phagosome maturation. Proc Natl Acad Sci U S A 101:13642–13647. doi: 10.1073/pnas.0401657101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Yang X-S, Tian Z-M, Yuan J-J, Zhang Y-T, Shao W. 2013. Numerical study on indoor wideband channel characteristics with different internal wall. Radioengineering 22:1169–1175. [Google Scholar]
- 5.Indrigo J, Hunter RL, Actor JK. 2003. Cord factor trehalose 6,6′-dimycolate (TDM) mediates trafficking events during mycobacterial infection of murine macrophages. Microbiology 149:2049–2059. doi: 10.1099/mic.0.26226-0. [DOI] [PubMed] [Google Scholar]
- 6.van der Wel N, Hava D, Houben D, Fluitsma D, van Zon M, Pierson J, Brenner M, Peters PJ. 2007. M. tuberculosis and M. leprae translocate from the phagolysosome to the cytosol in myeloid cells. Cell 129:1287–1298. doi: 10.1016/j.cell.2007.05.059. [DOI] [PubMed] [Google Scholar]
- 7.Simeone R, Bottai D, Brosch R. 2009. ESX/type VII secretion systems and their role in host-pathogen interaction. Curr Opin Microbiol 12:4–10. doi: 10.1016/j.mib.2008.11.003. [DOI] [PubMed] [Google Scholar]
- 8.Gedde MM, Higgins DE, Tilney LG, Portnoy DA. 2000. Role of listeriolysin O in cell-to-cell spread of Listeria monocytogenes. Infect Immun 68:999–1003. doi: 10.1128/iai.68.2.999-1003.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Portnoy DA, Auerbuch V, Glomski IJ. 2002. The cell biology of Listeria monocytogenes infection: the intersection of bacterial pathogenesis and cell-mediated immunity. J Cell Biol 158:409–414. doi: 10.1083/jcb.200205009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Roy CR, Berger KH, Isberg RR. 1998. Legionella pneumophila DotA protein is required for early phagosome trafficking decisions that occur within minutes of bacterial uptake. Mol Microbiol 28:663–674. doi: 10.1046/j.1365-2958.1998.00841.x. [DOI] [PubMed] [Google Scholar]
- 11.Derre I, Isberg RR. 2005. LidA, a translocated substrate of the Legionella pneumophila type IV secretion system, interferes with the early secretory pathway. Infect Immun 73:4370–4380. doi: 10.1128/IAI.73.7.4370-4380.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Brüggemann H, Cazalet C, Buchrieser C. 2006. Adaptation of Legionella pneumophila to the host environment: role of protein secretion, effectors and eukaryotic-like proteins. Curr Opin Microbiol 9:86–94. doi: 10.1016/j.mib.2005.12.009. [DOI] [PubMed] [Google Scholar]
- 13.Pérez-Lago L, Navarro Y, Montilla P, Comas I, Herranz M, Rodríguez-Gallego C, Ruiz Serrano MJ, Bouza E, García de Viedma D. 2015. Persistent infection by a mycobacterium tuberculosis strain that was theorized to have advantageous properties, as it was responsible for a massive outbreak. J Clin Microbiol 53:3423–3429. doi: 10.1128/JCM.01405-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.O’Reilly KM, Urban MA, Barriero T, Betts RF, Trawick DR. 2005. Persistent culture-positive Legionella infection in an immunocompromised host. Clin Infect Dis 40:e87–e89. doi: 10.1086/429826. [DOI] [PubMed] [Google Scholar]
- 15.Vazquez-Boland JA, Kuhun M, Berche P, Chakraborty T, Dominguez-Bernal G, Goebel W, Gonzalez-Zorn B, Wehland J, Kreft J. 2001. Listeria pathogenesis and molecular virulence determinants. Clin Microbiol Rev 14:584–640. doi: 10.1128/CMR.14.3.584-640.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Achkar JM, Casadevall A. 2013. Antibody-mediated immunity against tuberculosis: implications for vaccine development. Cell Host Microbe 13:250–262. doi: 10.1016/j.chom.2013.02.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Glatman-Freedman A. 2006. The role of antibody-mediated immunity in defense against Mycobacterium tuberculosis: advances toward a novel vaccine strategy. Tuberculosis 86:191–197. doi: 10.1016/j.tube.2006.01.008. [DOI] [PubMed] [Google Scholar]
- 18.de Valliere S, Abate G, Blazevic A, Heuertz RM, Hoft DF. 2005. Enhancement of innate and cell-mediated immunity by antimycobacterial antibodies. Infect Immun 73:6711–6720. doi: 10.1128/IAI.73.10.6711-6720.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Watanabe Y, Watari E, Matsunaga I, Hiromatsu K, Dascher CC, Kawashima T, Norose Y, Shimizu K, Takahashi H, Yano I, Sugita M. 2006. BCG vaccine elicits both T-cell mediated and humoral immune responses directed against mycobacterial lipid components. Vaccine 24:5700–5707. doi: 10.1016/j.vaccine.2006.04.049. [DOI] [PubMed] [Google Scholar]
- 20.Moliva JI, Turner J, Torrelles JB. 2017. Immune responses to bacillus Calmette-Guérin vaccination: why do they fail to protect against mycobacterium tuberculosis? Front Immunol 8:407. doi: 10.3389/fimmu.2017.00407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kato G, Kondo H, Aoki T, Hirono I. 2012. Mycobacterium bovis BCG vaccine induces non-specific immune responses in Japanese flounder against Nocardia seriolae. Fish Shellfish Immunol 33:243–250. doi: 10.1016/j.fsi.2012.05.002. [DOI] [PubMed] [Google Scholar]
- 22.Kato G, Kondo H, Aoki T, Hirono I. 2010. BCG vaccine confers adaptive immunity against Mycobacterium sp. infection in fish. Dev Comp Immunol 34:133–140. doi: 10.1016/j.dci.2009.08.013. [DOI] [PubMed] [Google Scholar]
- 23.Pasnik DJ, Smith SA. 2005. Immunogenic and protective effects of a DNA vaccine for Mycobacterium marinum in fish. Vet Immunol Immunopathol 103:195–206. doi: 10.1016/j.vetimm.2004.08.017. [DOI] [PubMed] [Google Scholar]
- 24.Kato G, Kato K, Saito K, Pe Y, Kondo H, Aoki T, Hirono I. 2011. Vaccine efficacy of Mycobacterium bovis BCG against Mycobacterium sp. infection in amberjack Seriola dumerili. Fish Shellfish Immunol 30:467–472. doi: 10.1016/j.fsi.2010.11.002. [DOI] [PubMed] [Google Scholar]
- 25.Kato G, Kato K, Jirapongpairoj W, Kondo H, Hirono I. 2014. Development of DNA vaccines against Nocardia seriolae infection in fish. Fish Pathol 49:165–172. doi: 10.3147/jsfp.49.165. [DOI] [Google Scholar]
- 26.Matsumoto M, Araki K, Nishimura S, Kuriyama H, Nakanishi T, Shiozaki K, Takeuchi Y, Yamamoto A. 2018. Adjuvant effect in aquaculture fish of cell-wall glycolipids isolated from acid-fast bacteria. Dev Comp Immunol 85:142–149. doi: 10.1016/j.dci.2018.04.012. [DOI] [PubMed] [Google Scholar]
- 27.Kai A, Nakagawa S. 1995. Relationship among recognition rate, rejection rate and false alarm rate in a spoken word recognition system. IEICE Trans Inf Syst 78:698–704. [Google Scholar]
- 28.Ho PY, Chen YC, Maekawa S, Hu HH, Tsai AW, Chang YF, Wang PC, Chen SC. 2018. Efficacy of recombinant protein vaccines for protection against Nocardia seriolae infection in the largemouth bass Micropterus salmoides. Fish Shellfish Immunol 78:35–41. doi: 10.1016/j.fsi.2018.04.024. [DOI] [PubMed] [Google Scholar]
- 29.Sypek JP, Chung CL, Mayor SE, Subramanyam JM, Goldman SJ, Sieburth DS, Wolf SE, Schaub RG. 1993. Resolution of cutaneous leishmaniasis: interleukin 12 initiates a protective T helper type 1 immune response. J Exp Med 177:1797–1802. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Gubler U, Chua AO, Schoenhaut DS, Dwyer CM, McComas W, Motyka R, Nabavi N, Wolitzky AG, Quinn PM, Familletti PC. 1991. Coexpression of two distinct genes is required to generate secreted bioactive cytotoxic lymphocyte maturation factor. Immunology 88:4143–4147. doi: 10.1073/pnas.88.10.4143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.D’Andrea A, Rengaraju M, Valiante NM, Chehimi J, Kubin M, Aste M, Chan SH, Kobayashi M, Young D, Nickbarg E. 1992. Production of natural killer cell stimulatory factor (interleukin 12) by peripheral blood mononuclear cells. J Exp Med 176:1387–1398. doi: 10.1084/jem.176.5.1387. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Matsumoto M, Hayashi K, Suetake H, Yamamoto A, Araki K. 2016. Identification and functional characterization of multiple interleukin 12 in amberjack (Seriola dumerili). Fish Shellfish Immunol 55:281–292. doi: 10.1016/j.fsi.2016.05.025. [DOI] [PubMed] [Google Scholar]
- 33.Wang T, Husain M. 2014. The expanding repertoire of the IL-12 cytokine family in teleost fish: identification of three paralogues each of the p35 and p40 genes in salmonids, and comparative analysis of their expression and modulation in Atlantic salmon Salmo salar. Dev Comp Immunol 46:194–207. doi: 10.1016/j.dci.2014.04.008. [DOI] [PubMed] [Google Scholar]
- 34.Matsumoto M, Araki K, Hayashi K, Takeuchi Y, Shiozaki K, Suetake H, Yamamoto A. 2017. Adjuvant effect of recombinant interleukin-12 in the nocardiosis formalin-killed vaccine of the amberjack Seriola dumerili. Fish Shellfish Immunol 67:263–269. doi: 10.1016/j.fsi.2017.06.025. [DOI] [PubMed] [Google Scholar]
- 35.Nascimento DS, do Vale A, Tomas AM, Zou J, Secombes CJ, dos Santos NMS. 2007. Cloning, promoter analysis and expression in response to bacterial exposure of sea bass (Dicentrarchus labrax L.) interleukin-12 p40 and p35 subunits. Mol Immunol 44:2277–2291. doi: 10.1016/j.molimm.2006.11.006. [DOI] [PubMed] [Google Scholar]
- 36.Yoshiura Y, Kiryu I, Fujiwara A, Suetake H, Suzuki Y, Nakanishi T, Ototake M. 2003. Identification and characterization of fugu orthologues of mammalian interleukin-12 subunits. Immunogenetics 55:296–306. doi: 10.1007/s00251-003-0582-9. [DOI] [PubMed] [Google Scholar]
- 37.Grohmann U, Belladonna ML, Vacca C, Bianchi R, Fallarino F, Orabona C, Fioretti MC, Puccetti P. 2001. Positive regulatory role of IL-12 in macrophages and modulation by IFN-γ. J Immunol 167:221–227. doi: 10.4049/jimmunol.167.1.221. [DOI] [PubMed] [Google Scholar]
- 38.Yabu T, Toda H, Shibasaki Y, Araki K, Yamashita M, Anzai H, Mano N, Masuhiro Y, Hanazawa S, Shiba H, Moritomo T, Nakanishi T. 2011. Antiviral protection mechanisms mediated by ginbuna crucian carp interferon gamma isoforms 1 and 2 through two distinct interferon gamma-receptors. J Biochem 150:635–648. doi: 10.1093/jb/mvr108. [DOI] [PubMed] [Google Scholar]
- 39.Aggad D, Stein C, Sieger D, Mazel M, Boudinot P, Herbomel P, Levraud JP, Lutfalla G, Leptin M. 2010. In vivo analysis of IFN- 1 and IFN- 2 signaling in zebrafish. J Immunol 185:6774–6782. doi: 10.4049/jimmunol.1000549. [DOI] [PubMed] [Google Scholar]
- 40.Yamasaki M, Araki K, Maruyoshi K, Matsumoto M, Nakayasu C, Moritomo T, Nakanishi T, Yamamoto A. 2015. Comparative analysis of adaptive immune response after vaccine trials using live attenuated and formalin-killed cells of Edwardsiella tarda in ginbuna crucian carp (Carassius auratus langsdorfii). Fish Shellfish Immunol 45:437–442 doi: 10.1016/j.fsi.2015.04.038. [DOI] [PubMed] [Google Scholar]
- 41.Zhao Z, Qian Y, Wald D, Xia Y-F, Geng J-G, and, Li X. 2003. IFN regulatory factor-1 is required for the up-regulation of the CD40-NF-κB activator 1 axis during airway inflammation. J Immunol 170:5674–5680. doi: 10.4049/jimmunol.170.11.5674. [DOI] [PubMed] [Google Scholar]
- 42.Abou El Hassan M, Huang K, Eswara MB, Xu Z, Yu T, Aubry A, Ni Z, Livne-Bar I, Sangwan M, Ahmad M, Bremner R. 2017. Properties of STAT1 and IRF1 enhancers and the influence of SNPs. BMC Mol Biol 18:6. doi: 10.1186/s12867-017-0084-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Bliss SK, Zhang Y, Denkers EY. 1999. Murine neutrophil stimulation by Toxoplasma gondii antigen drives high level production of IFN-gamma-independent IL-12. J Immunol 163:2081–2088. [PubMed] [Google Scholar]
- 44.Silva MT, Silva MN, Appelberg R. 1989. Neutrophil-macrophage cooperation in the host defence against mycobacterial infections. Microb Pathog 6:369–380. doi: 10.1016/0882-4010(89)90079-X. [DOI] [PubMed] [Google Scholar]
- 45.Pedrosa J, Saunders BM, Appelberg R, Orme IM, Silva MT, Cooper AM. 2000. Neutrophils play a protective nonphagocytic role in systemyc Mycobacterium tuberculosis infection of mice. Infect Immun 68:577–583. doi: 10.1128/IAI.68.2.577-583.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Fulton SA, Johnsen JM, Wolf SF, Sieburth DS, Boom WH. 1996. Interleukin-12 production by human monocytes infected with Mycobacterium tuberculosis: role of phagocytosis. Infect Immun 64:2523–2531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Ganaie AA, Trivedi G, Kaur A, Jha SS, Anand S, Rana V, Singh A, Kumar S, Sharma C. 2016. Interaction of Erp protein of Mycobacterium tuberculosis with Rv2212 enhances intracellular survival of Mycobacterium smegmatis. J Bacteriol 198:2841–2852. doi: 10.1128/JB.00120-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Berthet FX, Lagranderie M, Gounon P, Laurent-Winter C, Ensergueix D, Chavarot P, Thouron F, Maranghi E, Pelicic V, Portnoi D, Marchal G, Gicquel B. 1998. Attenuation of virulence by disruption of the Mycobacterium tuberculosis erp gene. Science 282:759–762. doi: 10.1126/science.282.5389.759. [DOI] [PubMed] [Google Scholar]
- 49.Cosma CL, Klein K, Kim R, Beery D, Ramakrishnan L. 2006. Mycobacterium marinum Erp is a virulence determinant required for cell wall integrity and intracellular survival. Infect Immun 74:3125–3133. doi: 10.1128/IAI.02061-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Kocíncová D, Sondén B, De Mendonça-Lima L, Gicquel B, Reyrat JM. 2004. The Erp protein is anchored at the surface by a carboxy-terminal hydrophobic domain and is important for cell-wall structure in Mycobacterium smegmatis. FEMS Microbiol Lett 231:191–196. doi: 10.1016/S0378-1097(03)00964-9. [DOI] [PubMed] [Google Scholar]
- 51.Besra GS, Brennan PJ. 1997. The mycobacterial cell envelope. J Pharm Pharmacol 49(Suppl 1):25–30. doi: 10.1111/j.2042-7158.1997.tb06146.x. [DOI] [PubMed] [Google Scholar]
- 52.Richardson MB, Williams SJ. 2014. MCL and Mincle: C-type lectin receptors that sense damaged self and pathogen-associated molecular patterns. Front Immunol 5:1–9. doi: 10.3389/fimmu.2014.00288. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Schreiber E, Matthias P, Muller MM, Schaffner W. 1989. Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Res 17:6419. doi: 10.1093/nar/17.15.6419. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.





