Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequencing and information about primers
| Gene Name | Sequence | Length | Tm | GC% |
|---|---|---|---|---|
| FNDC5(F) | ATGAAGGAGATGGGGAGGAA | 20 | 54.50 | 50.00 |
| FNDC5(R) | GCGGCAGAAGAGAGCTATAACA | 22 | 55.30 | 50.00 |
| GAPDH(F) | CACTGCCACCCAGAAGACTG | 20 | 55.20 | 60.00 |
| GAPDH(R) | CCAGTGAGCTTCCCGTTCAG | 20 | 56.80 | 60.00 |
