. 2019 Sep 22;10:218–230. doi: 10.1016/j.ijppaw.2019.09.005

Table 3.

Primers used for the amplification of per, COX1 and ITS2. Name, sequence, source and PCR protocols are described.

Gene	Name	Sequence	Source	Protocol
Gene	Name	Sequence	Source	ID	D	A	E	C	F
per	per5	GCCTTCAGATACGGTCAAAC	Williams and Villet (2013)	94 °C 5min	94 °C 30s	50 °C 1min	72 °C 30s	x36	72 °C 7min
	perreverse	CCGAGTGTGGTTTGGAGATT	Williams and Villet (2013)	94 °C 5min	94 °C 30s	50 °C 1min	72 °C 30s	x36	72 °C 7min
	pbf14	GGCGTTGTCAAGCTCTAGC	this study	94 °C 5min	94 °C 30s	48 °C 1min	72 °C 30s	x36	72 °C 7min
	pbf650-R	CCACGAATGTGAACCAACTC
	p249	GCAAACCAGTAACAGCACCT
	p433-R	GTGCCTGTACCGGTGTTG
COX1	LCO1490	GGTCAACAAATCATAAAGATATTGG	Folmer et al. (1994)	94 °C 5min	95 °C 30s	45 °C 30s	72 °C 1min	x35	72 °C 7min
COX1	HCO2198	TAAACTTCAGGGTGACCAAAAAATCA	Folmer et al. (1994)	94 °C 5min	95 °C 30s	45 °C 30s	72 °C 1min	x35	72 °C 7min
ITS2	ITS4	TCCTCCGCTTATTGATATGC	White et al. (1990)	*94 °C 2min	94 °C 30s	44 °C 35s	72 °C 30s	x38	72 °C 3min
ITS2	ITS5.8	GGGACGATGAAGAACGCAGC	White et al. (1990)	*94 °C 2min	94 °C 30s	44 °C 35s	72 °C 30s	x38	72 °C 3min

*ID = initial denaturation step, D = denaturation, A = annealing, E = extension, C = cycles of D-A-E, F = final extension.