| Antibodies |
|
|
| BUV 395 Hamster anti-Mouse CD11c (clone HL3) |
BD Horizon |
Cat# 564080; RRID:AB_2738580 |
| BUV 395 Hamster IgG1, λ1 Isotype Control (clone G235–2356) |
BD Horizon |
Cat# 564075 |
| BV 421 anti-Mouse CCr2 (clone SA203G11) |
BioLegend |
Cat# 150605; RRID:AB_2571913 |
| BV 605 anti-Mouse CD115 (clone AFS98) |
BioLegend |
Cat# 135517; RRID:AB_2562760 |
| PE anti-Mouse MerTK (Clone 2B10C42) |
BioLegend |
Cat# 151506; RRID:AB_2617037 |
| PE Rat IgG2a Isotype Control (Clone RTK2758) |
BioLegend |
Cat# 400508; RRID:AB_326530 |
| PerCP/Cy5.5 anti-Mouse/Human CD11b (clone M1/70) |
BioLegend |
Cat# 101228; RRID:AB_893232 |
| APC eflour 780 anti-Mouse Ly6C (clone HK1.4) |
Invitrogen |
Cat# 47–5932–82; RRID:AB_2573992 |
| PE Cy7 anti-Mouse F4/80 (clone BM8) |
BioLegend |
Cat# 123114; RRID:AB_893478 |
| PE Texas Red anti-Mouse CD45 |
Invitrogen |
Cat# MCD4517; RRID:AB_10392557 |
| PE anti-Mouse CD11c (clone N418) |
BioLegend |
Cat# 117307; RRID:AB_313776 |
| PE Armenian Hamster IgG1 (clone HTK888) |
BioLegend |
Cat# 400907; RRID:AB_326593 |
| BV 711 anti-Mouse CD64 (clone X45–5/7.1) |
BioLegend |
Cat# 139311; RRID:AB_2563846 |
| BV785 anti-Mouse Ly6G (clone 1A8) |
BioLegend |
Cat# 127645; RRID:AB_2566317 |
| FITC anti-Mouse Ly6G (clone 1A8) |
BioLegend |
Cat# 127606; RRID:AB_1236494 |
| FITC anti-Mouse NKp46 (clone 29A1.4) |
BioLegend |
Cat# 137606; RRID:AB_2298210 |
| FITC anti-Mouse CD49b clone DX5 |
BioLegend |
Cat# 108906; RRID:AB_313413 |
| FITC anti-Mouse CD19 (clone 65) |
BioLegend |
Cat# 115506; RRID:AB_313641 |
| FITC anti-Mouse TER119 (clone TER-119) |
BioLegend |
Cat# 116206; RRID:AB_313707 |
| FITC anti-Mouse CD3e (clone 145–2C11) |
BioLegend |
Cat# 100306; RRID:AB_312671 |
| FITC anti-Mouse TCRβ chain (Clone H57–597) |
BioLegend |
Cat# 109206; RRID:AB_313429 |
| FITC anti-Mouse CD11c (clone N418) |
BioLegend |
Cat# 117306; RRID:AB_313775 |
| Alexa Flour 700 anti-Mouse I-A/I-E (clone M5/114.15.2) |
BioLegend |
Cat# 107622; RRID:AB_493727 |
| BV 605 rat IgG2a, kappa Isotype control (Clone RTK2758) |
BioLegend |
Cat# 400539; RRID:AB_11126979 |
| APC anti-mouse NK-46 (clone 29A1.4) |
BioLegend |
Cat# 137607; RRID:AB_10612749 |
| APC anti-mouse B220 (clone RA3–6B2) |
BioLegend |
Cat# 103211; RRID:AB_312996 |
| APC anti-mouse CD90.2 (clone 53–2.1) |
BioLegend |
Cat# 140311; RRID:AB_10645337 |
| APC anti-mouse CD3 (clone 17A2) |
BioLegend |
Cat# 100236; RRID:AB_2561456 |
| APC anti-mouse CD19 (clone 65) |
BioLegend |
Cat# 115512; RRID:AB_313647 |
| Pacific Blue anti-mouse F4/80 |
Invitrogen |
Cat# MF48028; RRID:AB_10373419 |
| PE Dazzle 594 CD45.1 (clone A20) |
BioLegend |
Cat# 110748; RRID:AB_2564295 |
| APC CD45.1 (clone A20) |
BioLegend |
Cat# 110714; RRID:AB_313503 |
| PE/Dazzle 594 anti-mouse CD45.2 (Clone 104) |
BioLegend |
Cat# 109845; RRID:AB_2564176 |
| APC anti- mouse CD45.2 (clone 104) |
BioLegend |
Cat# 109813; RRID:AB_389210 |
| BV711 anti- mouse IgG1 Isotype control (clone MOPC-21) |
BioLegend |
Cat# 400167; RRID:AB_11218607 |
| PE Cy7 Rat IgG2a Isotype control (clone RTK2758) |
BioLegend |
Cat# 400522; RRID:AB_326542 |
| PE anti- mouse CD135 (clone A2F10) |
BioLegend |
Cat# 135305; RRID:AB_1877218 |
| PE Rat IgG2b Isotype control (clone eB149/10H5) |
eBioscience |
Cat# 12–4031–81; RRID:AB_470041 |
| Pacific Blue anti- mouse Ly6G (clone 1A8) |
BioLegend |
Cat# 127612; RRID:AB_2251161 |
| Pacific Blue anti-human/mouse CD11b (clone M1/70) |
BioLegend |
Cat# 101224; RRID:AB_755986 |
| BV421 anti-human/mouse CD11b (clone M1/70) |
BioLegend |
Cat# 101235; RRID:AB_10897942 |
| BUV 395 Rat anti-mouse CD117 (clone 2B8) |
BD Horizon |
Cat# 564011; RRID:AB_2738541 |
| BV650 anti-mouse Ly6G (clone 1A8) |
Biolegend |
Cat# 127641; RRID:AB_2565881 |
| BV785 anti-mouse CD45.2 (clone 104) |
Biolegend |
Cat# 109839; RRID:AB_2562604 |
| Donkey NL-557 anti-mouse IgG |
R&D Systems |
Cat# NL007; RRID:AB_663768 |
| Northern Lights 637 Streptavidin |
R&D Systems |
Cat# NL998; RRID:AB_10175723 |
| Goat anti-Rabbit IgG HNL |
Abcam |
Cat# AB150077; RRID:AB_2630356 |
| Human CD14 Biotinylated Antibody |
R&D Systems |
Cat# BAF383; RRID:AB_356435 |
| Recombinant CD16 antibody |
Abcam |
Cat# AB109223; RRID:AB_10863447 |
| Anti-CD68 antibody |
Abcam |
Cat# AB955; RRID:AB_ 307338 |
| LEAF Purified anti-mouse GM-CSF antibody (clone MP1–22E9) |
BioLegend |
Cat# 505408; RRID:AB_315384 |
| PerCP/Cy5.5 anti-human CD14 (clone 36D3) |
BioLegend |
Cat# 367110; RRID:AB_2566712 |
| PE-TR anti-human CD16 (clone 3G8) |
ThermoFisher |
Cat# MHCD1617; RRID:AB_1464937 |
| PE anti-human MerTK (clone 590H11G1E3) |
BioLegend |
Cat# 367608; RRID:AB_2566401 |
| BV711 anti-mouse/human CD11b (clone M1/70) |
BioLegend |
Cat# 101242; RRID:AB_2563310 |
| APC anti-human CD68 (Clone Y1/82a) |
BioLegend |
Cat# 333810; RRID:AB_2275735 |
| BUV395 anti-mouse/human CD45 (clone HI30) |
BD Biosciences |
Cat# 563791; RRID:AB_2744400 |
| APC Annexin V apoptosis Detection Kit with 7-AAD |
BioLegend |
Cat# 640930 |
| Biological Samples |
|
|
| Endomyocardial Biopsies |
University of Texas Health Science Center |
https://www.texasheart.org/; https://www.uth.edu/
|
| Giant Cell Endomyocardial Biopsies Sample |
University of Tubingen |
https://uni-tuebingen.de/en/university.html |
| Chemicals, Peptides, and Recombinant Proteins |
|
|
| 0.05% Trypsin-EDTA (1x) |
Life Technologies |
Cat#25300–054 |
| MyHCa614–629 |
GenScript |
Cat#639666–1 |
| Protease, Type XIV: Bacterial, From Streptomyces griseus
|
Sigma-Aldrich |
Cat#P5147–5G |
| Deoxyribonuclease I |
Worthington |
Cat#LS002139
|
| Collagenase II |
Worthington |
Cat#LS004177
|
| Pertussis Toxin from Bordetella pertussis
|
List Biological Laboratories, Inc. |
Cat#180, #181 |
| Mycobacterium Tuberculosis Des. H37 Ra |
BD |
231141 |
| L-Glutamine |
Corning Inc. |
Cat#25–005-CI |
| Freund’s Adjuvant Complete |
Sigma |
Cat#F5881–10X10ML |
| Sodium Pyruvate |
Sigma |
Cat#S8636 |
| Antibiotic antimycotic solution (100x) |
Corning Inc. |
Cat#30–004-CI |
| CellStripper |
Corning Inc. |
Cat#25–05-CI |
| 1M HEPES Buffer pH7.3 |
Quality Biological |
Cat#118–089–721 |
| Histopaque-1119 |
Sigma |
Cat#11191–6X100ML |
| HIstopaque-1077 |
Sigma |
Cat#10771–6X100ML |
| Bovine Serum Albumin |
Sigma |
Cat#A3608–100G |
| ACK Lysing Buffer |
Quality Biological |
Cat#118–156–721 |
| MEM NON-Essential Amino Acid solution 100x |
Sigma-Aldrich |
Cat# M7145 |
| Lysis Buffer RLT Plus |
QIAGEN |
Cat#1053393 |
| EDTA |
Corning Inc. |
Cat#46–034-CI |
| Fluoresbrite Plain YG 0.5 Micron Microspheres (2.5%Solids Latex) |
Polysciences, Inc. |
Cat#17152 |
| Differential Quik Stain Solution C Xanthene Dye |
Polysciences, Inc. |
Cat#24606C-250 |
| Differential Quik Stain Solution A Fixative |
Polysciences, Inc. |
Cat#24606A-250 |
| Differential Quik Stain Solution B Blue Dye |
Polysciences, Inc. |
Cat#24606B-250 |
| Liposomal Clodronate |
Clodrosome |
Cat#CLD-8909 |
| DMEM (1X) |
GIBCO |
Cat#11995–065 |
| Anti-Ly6G Microbead Kit mouse |
Miltenyi Biotec |
Cat#130–092–332 |
| Anti-CD11b Microbead Kit mouse/human |
Miltenyi Biotec |
Cat#130–049–601 |
| TRIzol reagent |
ThermoFisher |
Cat#15596026 |
| Heat Inactivated Fetal Bovine Serum |
ThermoFisher |
Cat#A3840001 |
| Recombinant Murine GM-CSF |
Peprotech |
Cat#315–03 |
| DAPI Solution (1mg/ml) |
ThermoFisher |
Cat#62248 |
| SafeFix II All-Purpose Fixative |
ThermoFisher |
Cat#23–042600 |
| Evans Blue |
Sigma |
Cat#E21129 |
| Sudan Black B |
Sigma |
Cat#199664–25G |
| BD Cytofix Fixation Buffer |
BD Biosciences |
Cat# 554655 |
| CountBright absolute counting beads |
Invitrogen |
Cat# C36850
|
| Anti-MoCD-16/CD32 |
eBioscience |
Cat#14–0161–86 |
| Forane Liquid for inhalation 100ml |
Baxter |
Cat#1001936040 |
| Buprenorphine (1mg/ml) |
ZooPharm |
Cat#BZ8069317 |
| Succinyl Choline (20mg/ml) |
Hospira, Inc. |
Cat# 81–081-EV |
| High Capacity cDNA reverse Transcription Kit |
FisherScientific |
Cat#4368814 |
| SYBR Green PCR Master Mix |
BioRad |
Cat#4367659 |
| CFSE CellTrace Cell Proliferation Kit |
Invitrogen |
Cat# C34554
|
| D-Glucose Anhydrous |
Amresco |
Cat3 0188–1KG |
| Magnesium Sulfate |
Amresco |
Cat# E797–500G |
| Potassium Chloride |
Sigma |
Cat# 60130–250G |
| Taurine |
Sigma |
Cat3T0625–100G |
| Tween 200 |
Sigma |
Cat3 P1379–500ML |
| Sodium Chloride |
Fisher BioReagents |
Cat#M-11615 |
| Sodium Bicarbonate |
Amresco |
Cat# 0865–1KG |
| Sodium phosphate dibasic heptahydrate, ACS regent |
Sigma |
Cat#S9390–500G |
| Potassium Phosphate monobasic |
Sigma |
Cat#P9791–100G |
| Heparin sodium salt from porcine intestinal mucosa |
Sigma |
Cat#H3393–10Ku |
| Triton X-100 |
Sigma |
Cat#T9284–100ML |
| 2,3-butanedione |
Sigma |
Cat# B0753–100G |
| RNeasy Micro Kit |
QIAGEN |
Cat#74004 |
| GeneChip 3′ IVT Pico Kit |
ThermoFisher |
Cat#902789 |
| Live/Dead Fixable Far Red Dead Cell Stain Kit |
Invitrogen |
Cat# L10120
|
| Live/Dead Fixable Aqua Dead Cell Stain Kit |
ThermoFisher |
Cat# L34966
|
| Critical Commercial Assays |
|
|
| Mouse MER ELISA Kit |
Abcam |
Cat#AB210572
|
| Human MER ELISA Kit |
Abcam |
Cat#AB119604
|
| Clariom S Assay, mouse |
ThermoFisher |
Cat#902930 |
| Deposited Data |
|
|
| Raw and analyzed microarray data |
This paper |
GEO: GSE118861
|
| Experimental Models: Organisms/Strains |
|
|
| Mouse: BALB/cJ |
The Jackson Laboratory |
Cat# 000651 |
| Mouse: CByJ.SJL(B6)-Ptprca/J |
The Jackson Laboratory |
Cat# 006584 |
| Mouse: IL-17Ra−/− (BALB/c) |
Amgen Inc.; Children’s Hospital University of Pittsburg Medical Center (Dr. J Kolls) |
Yu et al., 2008; Wu et al., 2014
|
| Mouse: IL-17Ra−/− (CByJ.SJL(B6)-Ptprca/J) |
This Paper |
N/a |
| Oligonucleotides |
|
|
|
Ccl2 forward primer (5′ to 3′): TTAAAAACCTGGATCGGAACCAA |
This paper |
N/A |
|
Ccl2 reverse primer (5′ to 3′): GCATTAGCTTCAGATTTACGGGT |
This paper |
N/A |
|
Hprt forward primer (5′ to 3′): TCAGTCAACGGGGGACATAAA |
This paper |
N/A |
|
Hprt reverse primer (5′ to 3′): GGGGCTGTACTGCTTAACCAG |
This paper |
N/A |
| Software and Algorithms |
|
|
| FlowJo |
FlowJo |
RRID:SCR_008520 |
| Cyt |
Amir et al., 2013; Becher et al., 2014
|
https://systemsbiology.columbia.edu/center-for-computational-biology-and-bioinformatics-c2b2 |
| MATLAB |
MATLAB |
RRID:SCR_001622 |
| PRISM |
PRISM |
RRID:SCR_005375 |
| Partek Genomics Suite |
Partek Genomics Suite |
RRID:SCR_011860 |
| Spotfire |
TIBCO |
RRID:SCR_008858 |
