Table 3.
Bacterial strains, plasmids and primers
| Reagent | Description | Source/Ref. |
|---|---|---|
| Strains | ||
| V. cholerae O395 | Wild-type classical O1, Ogawa, SmR | 1 |
| V. cholerae CL101 | O395, pCTX-Kmφ plasmid | 3 |
| V. cholerae ΔtcpA (RT4031) | O395 ΔtcpA | 52 |
| V. cholerae ΔtcpB (RT4368) | O395 ΔtcpB | 52 |
| V. cholerae RT4225 | O395, tcpA (H181A), pMT5:toxT | 26 |
| E. coli (DH5α) | F − endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ (lacZYA-argF)U169, hsdR17 (rK − mK+), λ– | Life Technologies |
| E. coli Origami (DE3) | Δ(ara-leu)7697 ΔlacX74 ΔphoA PvuII phoR araD139 ahpC galE galK rpsL F′[lac+ lacI q pro] (DE3) gor522::Tn10 trxB (KanR, StrR, TetR)4 | |
| E. coli SHuffle® T7 Express lysY Competent E. coli cells | MiniF lysY (CamR)/fhuA2 lacZ::T7 gene1 [lon] ompT ahpC gal λatt::pNEB3-r1-cDsbC (SpecR, lacIq) ΔtrxB sulA11 R(mcr-73::miniTn10–TetS)2 [dcm] R(zgb-210::Tn10–TetS) endA1 Δgor Δ(mcrC-mrr)114::IS10 | New England Biolabs |
| Plasmids | ||
| pJMA10.1 | pBAD22 derivative; araC replaced with PrhaB, Bla, ApR; NcoI site removed | 9 |
| ptcpB | pJMA10.1 containing the tcpB gene | 9 |
| ptcpB-E5Q | ptcpB, E5Q | 9 |
| ptcpB-E5D | ptcpB, E5D | 9 |
| ptcpB-E5V | ptcpB, E5V | 9 |
| pET-15b | Encodes an N-terminal His·Tag® sequence followed by a thrombin site, ApR, T7lac | Novagen |
| pET-15b-tcpB | pET:15b with the gene fragment encoding ΔN-TcpB (residues 25–423) inserted into the NdeI and BamHI sites downstream of the His·Tag | 9 |
| pET-15b-tcpB-pilin | pET:15b with the gene fragment encoding TcpB-pilin (residues 25–228) inserted into the NdeI and BamHI sites downstream of the His·Tag | This study |
| pET-15b-tcpB-C | pET:15b with the gene fragment encoding TcpB-C (residues 243–423) inserted into the NdeI and BamHI sites downstream of the His·Tag | This study |
| pET-15b-pIII | pET:15b with the gene fragment encoding pIII residues 1–355 (pIII-ΔTM) inserted into the NdeI and BamHI sites downstream of the His·Tag | This study |
| pET-15b-tcpA | pET:15b with the gene fragment encoding ΔN-TcpA (residues 29–199) inserted into the NdeI and XhoI sites downstream of the His·Tag | 53 |
| Primers | ||
| TcpB-pilin-for | CGGTCAGTCTTGCTTAAACCGGAGAAATAGCAAT | |
| TcpB-pilin-rev | ATTGCTATTTCTCCGGTTTAAGCAAGACTG ACCGCCA | |
| TcpB-C-for | GGAATTCCATATGTTTTTAGAAGATAGTGAGTTGTGTTGGGA | |
| TcpB-C-rev | TCGCGGATCCTTAATTTTCACACCATTGAAACGCTATAAA | |
| pIII-ΔTM-for | GGAATTCAATATGTCCGCCATCAATTGTG | |
| pIII-ΔTM-rev | CGTAGGATCCTTAGTGCAGGTTTTCAGAAAAGAGGGAG |