Table 1.

Primers and amplification conditions used in the first PCR step for all genes in this study. The capital letters in the primer sequences indicate the original C or G. For all genes, the positions refer to the TSS; for M13mp18, the position refers sequence entry X02513.1 (NCBI, GenBank)

Gene	Amplicons	Fw primer	Rv primer	Amplification conditions
Dao (PR1)	+ 3/+ 365	TagTTagagaagtTaggYtgYtYaYta	agattggtgaRRRaaaaaaggagaga	Denature at 95 °C for 2 min; 35 cycles of denaturing at 95 °C for 30 s, annealing at 52 °C for 40 s, and extension at 72 °C for 50 s. Final elongation at 72 °C for 6 m
Dao (PR2)	− 234/+ 137	gaaYagYagTgagYtagYtgg	caccaRccaRRaatRaaacacaa	Denature at 95 °C for 2 min; 38 cycles of denaturing at 95 °C for 30 s, annealing at 54 °C for 40 s, and extension at 72 °C for 50 s. Final elongation at 72 °C for 6 m
Srr	+ 27/+ 377	GTaTtgggagTaaaagTattTag	tttaaactccacaatccaAAcct	Denature at 95 °C for 2 min; 35 cycles of denaturing at 95 °C for 30 s, annealing at 57 °C for 40 s, and extension at 72 °C for 50 s. Final elongation at 72 °C for 6 m
Ddo	− 63/− 468	gtgtgtttTtgaggaggtgaTaTtTa	aActtaccctccattAAtccatAcc	Denature at 95 °C for 2 min; 36 cycles of denaturing at 95 °C for 30 s, annealing at 52 °C for 40 s, and extension at 72 °C for 50 s. Final elongation at 72 °C for 6 m
M13mp18	5946/6294	Ggtgaagggtaattagttgttgtt	ccaataccaaacttacatacct	Denature at 95 °C for 2 min; 33 cycles of denaturing at 95 °C for 30 s, annealing at 57 °C for 40 s, and extension at 72 °C for 50 s. Final elongation at 72 °C for 6 m