Abstract
Aim:
This article aimed to analyze the diarrheagenic potential of E. coli isolated from urinary tract infection (UTI) and to recognize the presence of antibiotic resistance genes.
Background:
The marked genome plasticity of Escherichia coli has allowed the emergence of resistant pathogenic strains displaying an unusual arrangement of genes.
Methods:
In this cross-sectional study, 110 E. coli were isolated from patients with the symptoms of UTI in Sanandaj, west of Iran between July and September - 2015. The isolates were examined by the disk diffusion method for antibiotic susceptibility test and by polymerase chain reaction for the presence of genes characteristic of diarrheagenic E. coli (DEC), Uropathogenic E. coli (UPEC) virulence genes, extended-spectrum β-lactamase blaCTX-M and plasmid-mediated quinolone resistance determinants, qnrA, qnrB, and qnrS.
Results:
The most and the least effective antibiotics were nitrofurantoin and cefotaxime (96.4% and 27.3% sensitivity, respectively). Of the 110 UTI isolates, 57.3% carried diarrheagenic genes. The bundle-forming pilus bfpA was the most prevalent diarrheagenic gene (39.1%). The most commonly detected DEC pathotype was enterotoxigenic E. coli (-ETEC, 12.7%). All the pathotypes carried the blaCTX-M and qnr. The -UPEC hly hemolysin and pap adhesin genes were mainly detected among ETEC isolates
Conclusion:
Our results indicated the presence of resistant diarrheagenic pathotypes in UTI-associated E. coli. Such isolates may have the capacity of causing both extraintestinal and intestinal infections. Based on our knowledge, this is the first report of the presence of qnr in ETEC from urine.
Key Words: Diarrheagenic Escherichia coli, Resistance, Urinary tract infection, Virulence factors
Introduction
Escherichia coli is a commensal inhabitant of the human gastrointestinal tract. However, some strains of E. coli can acquire specific virulence factors, taking on a more pathogenic nature. The pathogenic E. coli strains are classified as either diarrheagenic E. coli (DEC) or extraintestinal E. coli (1). DEC is a leading bacterial cause of diarrhea, mostly in children younger than five years. Currently, six major groups of DEC have been recognized: enterotoxigenic E. coli (ETEC), enterohemorrhagic E. coli (EHEC), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC) and diffusely adherent E. coli (DAEC) (2, 3).
ETEC strains produce a variety of adhesins and secret heat-labile (LT) and/or heat-stable (ST) enterotoxins. EHEC strains secret Shiga toxin (Stx), with receptors found on intestinal cells and in the kidney, which can lead to the hemolytic uremic syndrome. EPEC strains express a type IV pilus, named the bundle-forming pilus, which is involved in adhesion (3). Moreover, EPEC and some EHEC strain express the outer membrane adhesin intimin that promotes actin accumulation in eukaryotic cells. EIEC strains are involved in invasive intestinal infections and dysentery. EAEC strains, which cause persistent diarrhea (> 14 days), produce various types of adhesins, and a heat-stable enterotoxin. The most recently identified pathotype is DAEC; however, there is limited information on pathogenic characteristics of this pathotype (4).
E. coli strains have also been associated with extraintestinal infections, including urinary tract infections (UTIs). The primary causative agent of UTIs is uropathogenic E. coli (UPEC). UTI is one of the most common infections in humans and is more common among females. The UPEC strains carry different virulence genes such as adhesins and toxins that contribute to the development of the infectious process (1). Pyelonephritis-associated pilus (Pap), α-hemolysin (HlyA), -afimbrial adhesin (Afa) and cytotoxic necrotizing factor 1 (CNF1) are among the most important virulence factors of E. coli causing UTI (5, 6). Pap and Afa adhesins are involved in the tissue damage and development of chronic UTIs. Exotoxins such as HlyA and CNF1 are also implicated in the pathogenesis of UTIs and play a role in the invasion and dissemination of bacteria in the urinary tract (1).
In general, UTIs are caused by strains that are present in the intestinal tract and bear specific virulence genes. If these strains colonize the perineum, they may ascend the urethra and colonize the urinary tract, causing disease. Some UPEC strains have been found to carry characteristic markers of DEC pathotypes, becoming a potential cause of diarrhea. Alternatively, some DEC strains might represent potential uropathogens (4). Antibiotic treatment of bacterial infections plays a vital role in reducing morbidity and mortality; however, misuse and overuse of antibiotics have resulted in increased resistance. Because many patients with gastroenteritis are treated empirically, knowledge regarding the antimicrobial resistance in diarrheagenic pathogens is vital in selecting the most appropriate treatment (7). The spread of resistance among E. coli has resulted in limited effects of agents, such as trimethoprim-sulfamethoxazole, and increased reliance on newer broad-spectrum agents, such as fluoroquinolones and extended-spectrum cephalosporins. Unfortunately, the emergence of antibiotic resistance now threatens the use of these newer agents (8, 9). This mainly includes resistance caused by extended-spectrum β-lactamases (ESBLs). ESBLs comprise diverse groups, among which the CTX-M group is now the most prevalent ESBL type in most regions of the world (10). The genes encoding ESBLs are usually located on mobile plasmids that can harbor other resistance genes, such as plasmid-mediated quinolone-resistance (PMQR) genes. The PMQR determinants, termed qnr, encode small proteins that protect DNA topoisomerases from quinolones. Three major groups of qnr determinants are qnrA, qnrB and qnrS. Exposure to multi-drug resistant pathogenic E. coli may result in hard-to-treat infections (11).
In this study, we aimed to 1) determine the presence of four diarrheagenic pathotypes (EAEC, ETEC, EPEC, and EHEC) among 110 E. coli isolated from patients with the symptoms of UTI, 2) detect the presence of ESBL blaCTX-M and qnr genes in DEC pathotypes and 3) investigate the distribution of the most important UPEC virulence genes (hly, pap, afa, and cnf) among DEC pathotypes.
Methods
Bacterial isolates
In this cross-sectional study, we collected 110 nonduplicates E. coli from urine samples of patients with the symptoms of UTI in two teaching affiliated hospitals of Kurdistan University of Medical Sciences in Sanandaj, the center of Kurdistan Province in the west of Iran between July and September 2015. UTI was defined according to the 2015 European Association of Urology guidelines (12). E. coli isolates were identified according to the standard tests such as Gram staining, lactose fermentation, motility, indole test, citrate utilization, methyl red, Voges-Proskauer, and lysine decarboxylation (13). All E. coli isolates were stored at −70°C in Trypticase soy broth (Q-lab, USA), containing 15% v/v glycerol.
Susceptibility testing
Susceptibility of isolates was determined to 13 antibiotics by the disk diffusion method on Mueller - Hinton agar plates (Q-lab, USA) according to the 2017 Clinical and Laboratory Standards Institute (CLSI) guidelines (14). The following antibiotic disks (Rosco, Denmark) were used: imipenem (IPM) (10 μg), cefotaxime (CTX) (30 μg), ceftazidime (CAZ) (30 μg), amoxicillin/clavulanic acid (AMC) (20/10 μg), aztreonam (AZT) (30 μg), ciprofloxacin (CP) (5 μg), tetracycline (TE) (30 μg), gentamicin (GM) (10 μg), cefepime (FEP) (30 μg), cefoxitin (CFO) (30 μg), nalidixic acid (NA) (30 μg), SXT, and nitrofurantoin (FM) (300 μg).
Briefly, agar plates were inoculated with a standardized inoculum (0.5 McFarland, 1.5 ×108 colony-forming unit (Cfu)/ml) of the isolates. Then paper disks containing antimicrobial compounds were placed on the agar surface. The plates were incubated at 35°C for 16-18 h, and then the diameter of inhibition growth zones was measured (14). E. coli ATCC 25922 was used as quality control.
Preparation of DNA templates
Total DNA was obtained by the freeze-thaw method (15). Briefly, bacteria were pelleted from an overnight culture, suspended in sterile distilled water, and boiled at 100 °C for 10 min. The suspensions were then immediately placed on ice for 5 min. Samples taken through a total of three freezing-thawing cycles were centrifuged. The supernatants were collected and after quality check on a 1% agarose gel and quantitative assessment by measuring absorbance at the wavelength of 260 nm and by calculating A260/A280 ratio to determine the purity of DNA (16), were stored at -20 °C as DNA template stocks.
Detection of genes characteristic of diarrheagenic pathotypes of E. coli
Polymerase chain reaction (PCR) assays were performed with specific primers (SinaClon, Iran) to detect the following eight genes associated with four DEC pathotypes (EPEC, EHEC, ETEC, and EAEC) (Table 1) (4, 17): eaeA (structural gene for intimin of EPEC and EHEC), bfpA (structural gene for bundle-forming pilus of EPEC), stx1 and/or stx2 (Shiga toxins 1 and 2 of EHEC), eltB and/or estA (heat-labile (LT) and heat-stable (ST) enterotoxin genes of ETEC), pCVD (the nucleotide sequence of the EcoRI–PstI DNA fragment of pCVD432 of EAEC), and astA (heat-stable enterotoxin of EAEC).
Table 1.
Primer sequences, annealing temperatures and predicted length of PCR products
| Category | Target gene | Primer sequence (5′ to 3′)a | Fragment size (bp) | Annealing temperature (°C) |
Ref.b | |
|---|---|---|---|---|---|---|
| DEC type | ||||||
| ETEC | eltB | TCTCTATGTGCATACGGAGC CCATACTGATTGCCGCAAT |
322 | 54 | (17) | |
| estA | GCTAAACAAGTARGGTCTTCAAAA CCCGGTACARGCAGGATTACAACA |
147 | 60 | (17) | ||
| EPEC | eaeA | CTGAACGGCGATTACGCGAA CCAGACGATACGATCCAG |
917 | 55 | (18) | |
| bfpA | TTCTTGGTGCTTGCGTGTCTTTT TTTTGTTTGTTGTATCTTTGTAA |
367 | 50 | (17) | ||
| EHEC | stx1 | ATAAATCGCCATTCGTTGACTAC AGAACGCCCACTGAGATCATC |
180 | 62 | (18) | |
| stx2 | GGCACTGTCTGAAACTGCTCC TCGCCAGTTATCTGACATTCTG |
255 | 62 | (18) | ||
| EAEC | pCVD | CTGGCGAAAGACTGTATCAT CAATGTATAGAAATCCGCTGTT |
630 | 56 | (17) | |
| astA | CCATCAACACAGTATATCCGA GGTCGCGAGTGACGGCTTTGT |
111 | 59 | (4) | ||
| Antibiotic resistance | ||||||
| CTX-M | bla CTX-M | ATGTGCAGYACCAGTAARGT TGGGTRAARTARGTSACCAGA |
593 | 56 | (19) | |
| qnr | qnrA | ATTTCTCACGCCAGGATTTG GATCGGCAAAGGTTAGGTCA |
516 | 56 | (20) | |
| qnrB | GATCGTGAAAGCCAGAAAGG ACGATGCCTGGTAGTTGTCC |
469 | 58 | (20) | ||
| qnrS | ACGACATTCGTCAACTGCAA TAAATTGGCACCCTGTAGGC |
417 | 56 | (20) | ||
| Urovirulence factors | ||||||
| P-fimbriae | pap | GACGGCTGTACTGCAGGGTGTGGCG ATATCCTTTCTGCAGGGATGCAATA |
328 | 65 | (21) | |
| Afimbrial adhesin | afa | GCTGGGCAGCAAACTGATAACTCTC CATCAAGCTGTTTGTTCGTCCGCCG |
750 | 65 | (21) | |
| Hemolysin | hly | AACAAGGATAAGCACTGTTCTGGCT ACCATATAAGCGGTCATTCCCGTCA |
1177 | 65 | (22) | |
| Cytotoxic necrotizing factor 1 | cnf1 | AAGATGGAGTTTCCTATGCAGGAG CATTCAGAGTCCTGCCCTCATTATT |
498 | 65 | (22) | |
a R: G/A, S: G/C, Y: C/T; b Ref.: References
The minimum criteria for determination of DEC were defined as follows: the presence of bfpA and eaeA for typical EPEC (the presence of only eaeA for atypical EPEC), the presence of stx1 and/or stx2 for EHEC (the additional presence of eaeA for a typical EHEC), the presence of eltB and/or estA for ETEC, and the presence of pCVD for EAEC (17).
PCR was performed using a thermal cycler (Eppendorf, Germany) with the following conditions: initial denaturation of 5 min at 94 °C followed by 35 cycles of denaturation of 1 min at 94 °C, annealing of 1 min at different temperatures (Table 1), extension of 1 min at 72 °C, and a final extension of 7 min at 72 °C.
The following strains were used as controls: EPEC ATCC 43887 (eaeA, bfpA), ETEC ATCC 35401 (eltB, estA), EHEC ATCC 43890 (stx1, eaeA), EHEC ATCC 43889 (stx2, eaeA), EAEC strain 97R (pCVD), and E. coli K-12 (negative control). For the astA, clinical E. coli isolate containing the target gene was used as positive control.
Detection of bla CTX-M and qnr resistance genes
PCR tested the total DNA template for the presence of a blaCTX-M type of ESBLs, qnrA, qnrB, and qnrS. The primers (SinaClon, Iran) and the predicted sizes of amplicons are presented in Table 1.
PCR amplifications were carried out on a thermal cycler (Eppendorf, Germany) under the following conditions: initial denaturation at 94 °C for 5 min and 35 cycles of denaturation at 94 °C for 1 min, annealing for 1 min at different temperatures (Table 1), extension at 72 °C for 1 min, and final extension at 72 °C for 5 min.
Detection of UPEC virulence genes
Specific primers (SinaClon, Iran) were used to amplify the sequences of pap, afa, hly, and cnf-1 genes. Details of primer sequences and predicted sizes of the amplified products are given in Table 1.
The amplification was performed in a thermal cycler (Eppendorf, Germany) under the following conditions: Initial denaturation at 94°C for 5 min; then 35 cycles of denaturation at 94°C for 1 min, annealing at 65°C for 1 min, and elongation at 72°C for 1 min followed by a final elongation at 72°C for 7 min. Conditions were the same for all the virulence genes. Separation of PCR products
All PCR assays were performed in a final volume of 25 µL, containing 3 µL DNA template, 1.5 mM MgCl2, 0.2 mM of each dNTP, 1 U Taq DNA polymerase, 1X PCR buffer, and 0.4 µM of each primer (SinaClon, Iran). PCR products were separated by gel electrophoresis on a 1.5% agarose in 0.5X Tris-Borate EDTA (TBE) buffer. A molecular size marker (100-bp Plus DNA ladder, SinaClon, Iran) was included on each gel. The amplified DNA was then stained with safe stain (SinaClon, Iran) and visualized under UV transillumination.
Data analysis
The data were analyzed using SSPS software version 16.0. Pearson Chi-square test and Fisher’s exact test were used to determining statistical significance. A P value of < 0.05 was considered significant.
Results
A total of 110 E. coli isolates were collected from patients with the symptoms of UTI in Sanandaj, west of Iran. The male to female ratio of the patients was approximately 1:4 (21 males and 89 females), and the average age of the patients was approximately 38 years; the oldest patient was 93 years old (one patient), and three one-year-old was the youngest patients. Seventy-five of the 110 isolates were from outpatients and thus, 35 isolates were from hospitalized patients admitted to different wards including women (n = 13), pediatrics (n = 10), emergency (n = 6), men (n = 4), internal (n= 1), and infectious diseases (n = 1) wards.
Antibiotic susceptibility
Antibiotic susceptibility of the isolates was carried out using different classes of antibiotics. Of the 110 isolates, 96.4% were susceptible to nitrofurantoin (n= 106), 91.8% to cefoxitin (n= 101), 85.4% to imipenem (n = 94), 68.2% to amoxicillin-clavulanic acid (n= 75), 63.6% to aztreonam (n= 70), 62.7% to ceftazidime (n= 69), 57.3% to ciprofloxacin (n = 63), 52.7% to gentamicin (n= 58), 47.3% to nalidixic acid (n= 52), 44.5% to cefepime (n= 49), and 42.7% to tetracycline (n= 47). The least effective antibiotics were trimethoprim/sulfamethoxazole and cefotaxime, with the susceptibility rates of 30.9% (n= 34) and 27.3% (n= 30), respectively.
Detection of DEC pathotypes in urine samples
Among the 110 E. coli isolated from UTI, the most commonly detected DEC pathotype was ETEC (n= 14 isolates, 12.7%), followed by EHEC (n= 7, 6.4%; no typical EHEC), EAEC (n= 6, 5.45%), and EPEC (n= 6, 5.45%; 1 typical and 5 atypical isolates).
The heat-labile toxin gene (eltB), carried by ETEC, was detected in 14 of the 110 isolates (12.7%). The heat-stable toxin gene (estA) was not found. The stx2 and stx1 genes carried by EHEC were found in 7 (6.4%) and 0 isolates, respectively. The marker pCVD, associated with EAEC, was found in 6 (5.45%) isolates. The astA gene carried primarily by EAEC (but also by other pathotypes) (23) was detected in 7 (6.4%) isolates. From the seven astA -positive isolates, only one was EAEC. Among the 110 isolates, 43 isolates (39.1%) carried the EPEC bundle-forming pilus gene bfpA, and 6 (5.45%) carried eaeA, which codes for intimin.
Eight patients (7.3%) were colonized with more than one DEC pathotype. The following combinations were detected: ETEC + EAEC (n= 3 isolates), ETEC + EHEC (n= 2), ETEC + atypical EPEC (n= 2), and EAEC + atypical EPEC (n= 1).
Sixty- three of the 110 isolates (57.3%) carried at least one of the diarrheagenic genes; thus, 47 isolates (42.7%) did not harbor any of the target genes. No isolate was found to carry more than three genes. A total of 45 isolates (40.9%) carried one gene; 16 isolates (14.5%) two genes; and a combination of three genes was observed in only two isolates (1.8%). Table 2 represents the diarrheagenic profile (DP) of isolates. Seventeen DP were found. The most prevalent profile was DP4, which was found in 32 isolates (29.1%) and characterized by the presence of bfpA. The most prevalent combination patterns were bfpA - eltB and bfpA - stx2 (n= 3 isolates, 2.7%; each).
Table 2.
Diarrheagenic profiles of 110 Escherichia coli isolated from patients with urinary tract infection
| Profile | stx2 | stx1 | bfpA | eaeA | eltB | estA | pCVD | astA | Total strains (%) |
|---|---|---|---|---|---|---|---|---|---|
| DP1 | + | - | - | - | + | - | - | - | 2 (1.8) |
| DP2 | + | - | + | - | - | - | - | - | 3 (2.7) |
| DP3 | + | - | - | - | - | - | - | - | 2 (1.8) |
| DP4 | - | - | + | - | - | - | - | - | 32 (29.1) |
| DP5 | - | - | + | - | - | - | + | - | 1 (0.9) |
| DP6 | - | - | + | - | - | - | - | + | 2 (1.8) |
| DP7 | - | - | + | - | + | - | - | - | 3 (2.7) |
| DP8 | - | - | + | - | + | - | + | - | 1 (0.9) |
| DP9 | - | - | + | + | - | - | - | - | 1 (0.9) |
| DP10 | - | - | - | + | - | - | + | - | 1 (0.9) |
| DP11 | - | - | - | + | + | - | - | - | 2 (1.8) |
| DP12 | - | - | - | + | - | - | - | - | 2 (1.8) |
| DP13 | - | - | - | - | + | - | - | - | 4 (3.6) |
| DP14 | - | - | - | - | + | - | + | + | 1 (0.9) |
| DP15 | - | - | - | - | + | - | + | - | 1 (0.9) |
| DP16 | - | - | - | - | - | - | + | - | 1 (0.9) |
| DP17 | - | - | - | - | - | - | - | + | 4 (3.6) |
DP: Diarrheagenic profile, +: Positive, -: Negative
Distribution of ESBL bla CTX-M and qnr genes
Among the 110 isolates, 38 isolates (34.5%) carried blaCTX-M, 16 isolates (14.5%) qnrS and 3 (2.7%) qnrB. The qnrA was not found. The prevalence of resistance genes was higher in the 63 isolates carrying diarrheagenic genes than the 47 isolates without these genes (blaCTX-M: 38.1% vs. 29.8%; qnrB: 4.8% vs. 0%; and qnrS: 15.9% vs. 12.8%, respectively), although significant differences were not found.
The blaCTX-M was found in EHEC (4 of 7), ETEC (6 of 14), and EAEC and EPEC (2 of 6, each) isolates. The qnrB was detected in EHEC and ETEC (n=1, each), and it was not found in EPEC and EAEC. The qnrS was found in all the pathotypes (3 ETEC, 1 EAEC, 2 EHEC, and 2 EPEC). One ETEC isolate and 1 EHEC harbored the three resistance genes, simultaneously. Two EPEC, 2 ETEC, 1 EAEC, and 1 EHEC harbored the qnrS and blaCTX-M, simultaneously.
Of the 13 tested antibiotics, nitrofurantoin was the most effective antibiotic against all the DEC pathotypes (100% sensitivity). Among the individual groups, EHEC isolates were mostly sensitive to amoxicillin/clavulanic acid and imipenem. In EPEC, ETEC, and EAEC isolate, sensitivity was found mostly for cefoxitin and imipenem (Table 3). For all the DEC pathotypes, less sensitivity was observed for trimethoprim-sulfamethoxazole, tetracycline, and cefotaxime. Multidrug resistance (non-susceptibility to at least one agent in three or more antimicrobial categories (24)) was seen in ETEC (12 of 14), EHEC (5 of 7), and EPEC and EAEC (5 of 6, each) isolates.
Table 3.
Antibiotic susceptibility patterns of diarrheagenic pathotypes of 110 Escherichia coli isolated from patients with urinary tract infection
| DEC pathotype | Susceptibility patterna |
|---|---|
| EPEC (n=6) | IPM,FM,AMC,CFO (2 isolates) |
| CP,CTX,IPM,CAZ,NA,FM,AZT,CFO | |
| CP,SXT,GM,IPM,CAZ,FM,AZT,CFO | |
| CP,GM,CTX,CAZ,NA,FM,FEP,AMC,AZT,CFO | |
| CP,SXT,GM,TE,IPM,CAZ,NA,FM,FEP,AMC,AZT,CFO | |
| EHEC (n=7) | GM,IPM,FM,AMC |
| IPM,FM,AMC,CFO | |
| CP,TE,FM,AMC,CFO | |
| CP,GM,IPM,FM,AMC,CFO | |
| IPM,CAZ,FM,FEP, AMC,AZT | |
| CP,SXT,TE,IPM,CAZ,NA,FM,FEP,AMC,AZT,CFO | |
| CP,SXT,GM,TE,IPM,CAZ,NA,FM,AMC,AZT,CFO | |
| EAEC (n=6) | GM,FM,CFO |
| CP,IPM,NA,FM,CFO | |
| CP,SXT,GM,IPM,CAZ,FM,AZT,CFO | |
| CP,TE,IPM,CAZ,FM,FEP,AMC,AZT,CFO | |
| CP,GM,TE,IPM,CAZ,FM,FEP,AMC,AZT,CFO | |
| CP,SXT,CTX,TE,IPM,CAZ,NA,FM,AMC,AZT,CFO | |
| ETEC (n=14) | FM,AZT,CFO |
| GM,IPM,FM | |
| IPM,FM,AMC,CFO | |
| CP,IPM,NA,FM,CFO | |
| CP,TE,FM,AMC,CFO | |
| CP,GM,IPM,FM,AMC,CFO (n=2 isolates) | |
| CP,CTX,IPM,CAZ,NA,FM,AZT,CFO | |
| CP,TE,IPM,CAZ,FM,FEP,AMC,AZT,CFO | |
| CP,GM,CTX,CAZ,NA,FM,FEP,AMC,AZT,CFO | |
| CP,CTX,IPM,CAZ,NA,FM,FEP,AMC,AZT,CFO | |
| CP,SXT,GM,IPM,CAZ,FM,FEP,AMC,AZT,CFO | |
| CP,SXT,CTX,TE,IPM,CAZ,NA,FM,AMC,AZT,CFO | |
| CP,SXT,GM,CTX,TE,IPM,CAZ,NA,FM,FEP,AMC,AZT,CFO |
aCP, Ciprofloxacin ; SXT, Trimethoprim-sulfamethoxazole; GM, Gentamicin; CTX, Cefotaxime; TE, Tetracycline; IPM, Imipenem; CAZ, Ceftazidime; NA, Nalidixic acid; FM, Nitrofurantoin; FEP, Cefepime; AMC, Amoxicillin/clavulanic acid; AZT, Aztreonam; CFO, Cefoxitin
Distribution of UPEC virulence genes among the DEC isolates
Of the 110 isolates, the pap was found in 38 (34.5%) isolates, the cnf in 31 (28.2%), the hly in 22 (20%), and the afa in 11 (10%) isolates. Forty- five isolates (40.9%) were negative for all the UPEC virulence genes. Significant associations were detected between the presence of hly and pap (P= 0.001), hly and cnf (P= 0.044), pap and cnf (P= 0.018), and pap and afa (P= 0.015).
The prevalence of the studied UPEC genes was higher in the 63 isolates carrying diarrheagenic genes than the 47 isolates without these genes. Of the 63 isolates, 28 (44.4%) carried pap, 20 (31.7%) carried cnf, 15 (23.8%) hly, and 7 (11.1%) afa. Significant positive associations were seen between the presence of pap and bfp (P = 0.034) and pap and astA(P = 0.007). Eighteen of the 63 isolates (28.6%) did not carry any of the studied urovirulence genes.
Among the toxins, the hly was mainly observed in ETEC (4 of 14) isolates. It was also found in EHEC (1 of 7), and EPEC and EAEC (1 of 6, each) isolates. The cnf was found in 3 EPEC, 3 ETEC, and 2 EHEC. For the adhesin genes, the pap was mainly detected in ETEC (4 of 14), and EHEC (2 of 7) isolates. It was also found in EPEC, and EAEC (1 of 6, each) isolates. The afa was found in 2 EHEC, 1 ETEC, 1 EPEC, and 1 EAEC
Discussion
The marked genome plasticity of E. coli has allowed the emergence of strains displaying an unusual arrangement of virulence genes. The ability of such strains to cause infection is not only dependent on their virulence traits, but also risk factors, such as age, immunosuppression, high levels of antimicrobials, and long-term indwelling catheterization (23).
In this study, we evaluated the presence of four diarrheagenic pathotypes (EAEC, ETEC, EPEC, and EHEC) in E. coli isolated from UTI. Relatively limited data are available regarding the existence of DEC pathotypes in UTI. Most other investigators have found EAEC as the most frequent DEC isolated from UTIs (4, 25, 26). We discovered that ETEC was the most frequent DEC pathotype in our isolates from UTI in Iran and a study in Germany (23) reported three EHEC isolates, one atypical EPEC, and one EAEC among 265 E. coli isolated from UTIs. In addition, Khaleque et al. found three ETEC isolates, one EHEC, and one EAEC among 56 UPEC strains (27).
To our knowledge, no previous study in Iran has investigated the simultaneous presence of four diarrheagenic pathotypes (EAEC, EPEC, ETEC, and EHEC) in UTI-associated E. coli and almost all of them have focused on the presence of some pathotypes especially EHEC in UTI. Navidinia et al., in Iran, investigated the prevalence of EHEC from UTI in children. They found that only 5 (1.3%) of 378 E. coli were EHEC according to their PCR results (28). In the study of Salmani et al., out of 100 E. coli isolated from UTI in Iran, 22% of the isolates were ETEC, while EPEC was not found (29). In another study from Iran, only 3% of the studied sample were EHEC, and 2% were EPEC (30).
Some of our UTI-associated DEC did not carry any of the four studied urovirulence genes. Although other urovirulence genes may be present in our strains which are not looked at in the present study, several studies have reported the uropathogenic role of diarrheagenic genes. The results of Toval et al. indicated that Stxs produced by EHEC could contribute to the uropathogenicity of EHEC (31). Furthermore, the eae which codes for adhesin intimin was reported to accumulate actin in kidney cells (4). Although a uropathogenic role for the bundle-forming pilus has not been demonstrated, the widespread presence of the bfpA (39.1%) in our UTI isolates may warrant efforts to understand its potential role in UTI. The urovirulence mechanism of ETEC has not been identified. Since adherence to epithelial surfaces is a crucial first step in the development of UTI (25); thus, adhesins of ETEC (32) may contribute to the uropathogenicity. Besides, the hly and pap were mainly detected among the ETEC. Seven (6.4%) of our isolates carried the astA. Some studies have also reported the presence of the astA in UTI isolates (23, 33) and its role in UPEC pathogenesis needs to be clarified. Significant associations were found between the presence of pap – bfp and pap - astA in our study. Taking into account the fact that the gut is the primary source of E. coli causing UTI (31), the presence of different adhesins, with affinity to distinct receptors, confers advantages to pathogens (34). Furthermore, the production of α-hemolysin among EAEC has been associated with the development of persistent diarrhea (2).
Patients with UTI need prompt antibacterial treatment, and empirical antibiotic therapy is usually started in patients with suspected UTI (1). However, the presence of DEC pathotypes in UTI isolates may pose a serious clinical challenge. Most notably, antibiotic therapy for EHEC infections is generally not recommended because antibiotics induce increased levels of Stxs production (35, 36). On the other hand, Stxs contribute to the uropathogenicity of EHEC (31). Also, the presence of resistance genes in UTI-associated DEC isolates means that these strains might play a role in therapeutic failures of both UTI and diarrhea. Among our UTI-associated DEC isolates, less sensitivity was observed for trimethoprim-sulfamethoxazole, cefotaxime, and tetracycline, and this may be due to the widespread use of these antibiotics in the treatment of UTIs (37). Antimicrobial therapy is indicated for diarrhea in a variety of circumstances (10), and in developing countries, where the overuse and misuse of antibiotics are common, the widespread use of antibiotics such as tetracycline and trimethoprim-sulfamethoxazole to treat diarrhea, has resulted in a high level of resistance among DEC (7, 10, 38). Due to the emergence of resistance, effective antibiotics such as quinolones can be used for the treatment of diarrhea (39). However, the first occurrence of qnrB and qnrS in EHEC and atypical EPEC isolates from diarrhea was reported from Spain in 2016 (39). Moreover, Riveros et al. in Peru, reported the presence of qnr in EAEC isolated from diarrhea (40). Our study showed the first presence of qnrB and qnrS in ETEC from UTI. The qnr genes are commonly associated with the other genes, such as ESBL blaCTX-M (11). Although ESBL-positive EHEC still seems to be a rare phenomenon (41), we found the presence of CTX-M in EHEC and also the other DEC pathotypes from UTI, and this may indicate a clinical challenge.
In conclusion, our results indicated ETEC as the most prevalent DEC pathotype in E. coli isolated from UTIs in the west of Iran and the presence of resistant diarrheagenic pathotypes. Such isolates may have the capacity of causing both extraintestinal and intestinal infections. Although our study reports the occurrence of resistance genes in the DEC pathotypes isolated from UTI, whether these resistant UTI- associated DEC pathotypes play a role in diarrhea need to be elucidated. The possibility that some resistant UPEC may have acquired DEC markers, or that some resistant DEC may have acquired UPEC properties, might play a significant role in therapeutic failures of human infections. The appropriate use of antimicrobials is essential given the threats posed by antimicrobial resistance because many patients with diarrhea and UTI are treated empirically and antibiotics may not be effective.
Acknowledgment
The authors would like to thank all people who helped in the collection of E. coli isolates. This work was supported by a grant [IR.MUK.REC.1395.57] from Social Determinants of Health Research Center, Research Institute for Health Development, Kurdistan University of Medical Sciences, Sanandaj, Iran.
Conflict of interests
The authors declare that they have no conflict of interest.
References
- 1.Bien J, Sokolova O, Bozko P. Role of uropathogenic Escherichia coli virulence factors in the development of urinary tract infection and kidney damage. Int J Nephrol. 2012:2012. doi: 10.1155/2012/681473. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Regua-Mangia AH, Irino K, da Silva Pacheco R, Pimentel Bezerra RM, Santos Périssé AR, Teixeira LM. Molecular characterization of uropathogenic and diarrheagenic Escherichia coli pathotypes. J Basic Microbiol. 2010;50:S107–15. doi: 10.1002/jobm.200900364. [DOI] [PubMed] [Google Scholar]
- 3.Haghi F, Zeighami H, Hajiahmadi F, Khoshvaght H, Bayat M. Frequency and antimicrobial resistance of diarrhoeagenic Escherichia coli from young children in Iran. J Med Microbiol. 2014;63:427–32. doi: 10.1099/jmm.0.064600-0. [DOI] [PubMed] [Google Scholar]
- 4.Abe CM, Salvador FA, Falsetti IN, Vieira MA, Blanco J, Blanco JE, et al. Uropathogenic Escherichia coli (UPEC) strains may carry virulence properties of diarrhoeagenic E. coli. FEMS Immunol Med Microbiol. 2008;52:397–406. doi: 10.1111/j.1574-695X.2008.00388.x. [DOI] [PubMed] [Google Scholar]
- 5.Lee J, Subhadra B, Son YJ, Kim D, Park H, Kim J, et al. Phylogenetic group distributions, virulence factors and antimicrobial resistance properties of uropathogenic Escherichia coli strains isolated from patients with urinary tract infections in South Korea. Lett Appl Microbiol. 2016;62:84–90. doi: 10.1111/lam.12517. [DOI] [PubMed] [Google Scholar]
- 6.Jadhav S, Hussain A, Devi S, Kumar A, Parveen S, Gandham N, et al. Virulence characteristics and genetic affinities of multiple drug resistant uropathogenic Escherichia coli from a semi urban locality in India. PloS One. 2011;6:e18063. doi: 10.1371/journal.pone.0018063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Jafari F, Hamidian M, Rezadehbashi M, Doyle M, Salmanzadeh-ahrabi S, Derakhshan F, et al. Prevalence and antimicrobial resistance of diarrheagenic Escherichia coli and Shigella species associated with acute diarrhea in Tehran, Iran. Canadian J Inf Dis Med Microbiol. 2009;20:e56–62. doi: 10.1155/2009/341275. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Odeh R, Kelkar S, Hujer A, Bonomo R, Schreckenberger P, Quinn JP. Broad resistance due to plasmid-mediated AmpC β-lactamases in clinical isolates of Escherichia coli. Clin Infect Dis. 2002;35:140–5. doi: 10.1086/340742. [DOI] [PubMed] [Google Scholar]
- 9.Karaca Y, Coplu N, Gozalan A, Oncul O, Citil BE, Esen B. Co-trimoxazole and quinolone resistance in Escherichia coli isolated from urinary tract infections over the last 10 years. Int J Antimicrob Agents. 2005;26:75–7. doi: 10.1016/j.ijantimicag.2005.03.012. [DOI] [PubMed] [Google Scholar]
- 10.Amaya E, Reyes D, Vilchez S, Paniagua M, Möllby R, Nord CE, et al. Antibiotic resistance patterns of intestinal Escherichia coli isolates from Nicaraguan children. J Med Microbiol. 2011;60:216–22. doi: 10.1099/jmm.0.020842-0. [DOI] [PubMed] [Google Scholar]
- 11.Jiang Y, Zhou Z, Qian Y, Wei Z, Yu Y, Hu S, et al. Plasmid-mediated quinolone resistance determinants qnr and aac (6′)-Ib-cr in extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in China. J Antimicrob Chemother. 2008;61:1003–6. doi: 10.1093/jac/dkn063. [DOI] [PubMed] [Google Scholar]
- 12.Grabe M, Bartoletti R, Bjerklund Johansen TE, Cai T, Çek M, Köves B, et al. for the European Association of Urology. Guidelines on Urological Infections. 2015. Available from: http://uroweb.org/wp-content/uploads/19-Urological-infections_LR2.pdf.
- 13.Tille P, editor. Bailey & Scott's diagnostic microbiology. 13th edition. . London: Elsevier Health Sciences, Mosby; 2015. [Google Scholar]
- 14.Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. 27th edition. Wayne: Clinical and Laboratory Standards Institute; 2017. [Google Scholar]
- 15.Kuske CR, Banton KL, Adorada DL, Stark PC, Hill KK, Jackson PJ. Small-scale DNA sample preparation method for field PCR detection of microbial cells and spores in soil. Appl Environ Microbiol . 1998;64:2463–72. doi: 10.1128/aem.64.7.2463-2472.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Khare P, Raj V, Chandra S, Agarwal S. Quantitative and qualitative assessment of DNA extracted from saliva for its use in forensic identification. J Forensic Dent Sci. 2014;6:81. doi: 10.4103/0975-1475.132529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Nguyen TV, Le Van P, Le Huy C, Gia KN, Weintraub A. Detection and characterization of diarrheagenic Escherichia coli from young children in Hanoi, Vietnam. J Clin Microbiol. 2005;43:755–60. doi: 10.1128/JCM.43.2.755-760.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Aranda K, Fagundes-Neto U, Scaletsky IC. Evaluation of multiplex PCRs for diagnosis of infection with diarrheagenic Escherichia coli and Shigella spp. J clin Microbiol. 2004;42:5849–53. doi: 10.1128/JCM.42.12.5849-5853.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Pagani L, Dell'Amico E, Migliavacca R, D'Andrea MM, Giacobone E, Amicosante G, et al. Multiple CTX-M-type extended-spectrum β-lactamases in nosocomial isolates of Enterobacteriaceae from a hospital in northern Italy. J clin Microbiol. 2003;41:4264–9. doi: 10.1128/JCM.41.9.4264-4269.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Robicsek A, Strahilevitz J, Sahm D, Jacoby G, Hooper D. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrobial Agents Chemother. 2006;50:2872–4. doi: 10.1128/AAC.01647-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Le Bouguenec C, Archambaud M, Labigne A. Rapid and specific detection of the pap, afa, and sfa adhesin-encoding operons in uropathogenic Escherichia coli strains by polymerase chain reaction. J Clin Microbiol. 1992;30:1189–93. doi: 10.1128/jcm.30.5.1189-1193.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Yamamoto S, Terai A, Yuri K, Kurazono H, Takeda Y, Yoshida O. Detection of urovirulence factors in Escherichia coli by multiplex polymerase chain reaction. FEMS Immunol Med Microbiol. 1995;12:85–90. doi: 10.1111/j.1574-695X.1995.tb00179.x. [DOI] [PubMed] [Google Scholar]
- 23.Toval F, Köhler C-D, Vogel U, Wagenlehner F, Mellmann A, Fruth A, et al. Characterization of Escherichia coli isolates from hospital inpatients or outpatients with urinary tract infection. J Clin Microbiol . 2013:02069–13. doi: 10.1128/JCM.02069-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Magiorakos AP, Srinivasan A, Carey R, Carmeli Y, Falagas M, Giske C, et al. Multidrug‐resistant, extensively drug‐resistant and pandrug‐resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18:268–81. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
- 25.Boll EJ, Struve C, Boisen N, Olesen B, Stahlhut SG, Krogfelt KA. Role of enteroaggregative Escherichia coli virulence factors in uropathogenesis. Infect Immun . 2013:01376–12. doi: 10.1128/IAI.01376-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Olesen B, Scheutz F, Andersen RL, Menard M, Boisen N, Johnston B, et al. Enteroaggregative Escherichia coli O78: H10—the cause of an outbreak of urinary tract infection. J Clin Microbiol . 2012:01909–12. doi: 10.1128/JCM.01909-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Khaleque M, Akter S, Akhter H, Khan SI, Begum A. Analysis of diarrheagenic potential of uropathogenic Escherichia coli isolates in Dhaka, Bangladesh. J Infect Dev Ctries. 2017;11:459–69. doi: 10.3855/jidc.8257. [DOI] [PubMed] [Google Scholar]
- 28.Navidinia M, Karimi A, Rahbar M, Fallah F, Ahsani RR, Malekan MA, et al. Study prevalence of verotoxigenic E coli isolated from urinary tract infections (UTIs) in an Iranian children hospital. Open Microbiol J. 2012;6 doi: 10.2174/1874285801206010001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Salmani H, Azarnezhad A, Fayazi MR, Hosseini A. Pathotypic and phylogenetic study of diarrheagenic Escherichia coli and uropathogenic E coli using multiplex polymerase chain reaction. Jundishapur J Microbiol. 2016:9. doi: 10.5812/jjm.28331. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Adeli Z, Firoozeh F, Zibaei M, Shakib P. Prevalence of Shiga toxin and Intimine genes in Shiga toxin-producing Escherichia coli isolated from urine samples in Lorestan, Iran. Feyz. 2013;17:188–94. [Google Scholar]
- 31.Toval F, Schiller R, Meisen I, Putze J, Kouzel IU, Zhang W, et al. Characterization of urinary tract infection-associated Shiga toxin-producing Escherichia coli. Infect Immun . 2014:01701–14. doi: 10.1128/IAI.01701-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Del Canto F, Botkin DJ, Valenzuela P, Popov V, Ruiz-Perez F, Nataro JP, et al. Identification of the Coli Surface Antigen 23 (CS23), a Novel Adhesin of Enterotoxigenic Escherichia coli. Infect Immun. 2012:00263–12. doi: 10.1128/IAI.00263-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Mirzarazi M, Rezatofighi SE, Pourmahdi M, Mohajeri MR. Occurrence of genes encoding enterotoxins in uropathogenic Escherichia coli isolates. Braz J Microbiol. 2015;46:155–9. doi: 10.1590/S1517-838246120130860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Jantunen ME, Saxen H, Lukinmaa S, Ala-Houhala M, Siitonen A. Genomic identity of pyelonephritogenic Escherichia coli isolated from blood, urine and faeces of children with urosepsis. J Med Microbiol. 2001;50:650–2. doi: 10.1099/0022-1317-50-7-650. [DOI] [PubMed] [Google Scholar]
- 35.Ishii Y, Kimura S, Alba J, Shiroto K, Otsuka M, Hashizume N, et al. Extended-spectrum β-lactamase-producing shiga toxin gene (stx1)-positive Escherichia coli O26: H11: a new concern. J Clin Microbiol. 2005;43:1072–5. doi: 10.1128/JCM.43.3.1072-1075.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Bielaszewska M, Idelevich EA, Zhang W, Bauwens A, Schaumburg F, Mellmann A, et al. Effects of antibiotics on Shiga toxin 2 production and bacteriophage induction by epidemic Escherichia coli O104: H4 strain. Antimicrob Agents Chemother. 2012;56:3277–82. doi: 10.1128/AAC.06315-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Oliveira F, Paludo K, Arend L, Farah S, Pedrosa F, Souza E, et al. Virulence characteristics and antimicrobial susceptibility of uropathogenic Escherichia coli strains. Genet Mol Res. 2011;10:4114–25. doi: 10.4238/2011.October.31.5. [DOI] [PubMed] [Google Scholar]
- 38.Canizalez-Roman A, Flores-Villaseñor HM, Gonzalez-Nuñez E, Velazquez-Roman J, Vidal JE, Muro-Amador S, et al. Surveillance of Diarrheagenic Escherichia Coli strains isolated from diarrhea cases from children, adults and elderly at northwest of Mexico. Front Microbiol. 2016;7 doi: 10.3389/fmicb.2016.01924. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Herrera-León S, Llorente MT, Sánchez S. Plasmid-Mediated Quinolone Resistance in Different Diarrheagenic Escherichia coli Pathotypes Responsible for Complicated, Noncomplicated, and Traveler's Diarrhea Cases. Antimicrobi Agents Chemother. 2016;60:1950–1. doi: 10.1128/AAC.02909-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Riveros M, Riccobono E, Durand D, Mosquito S, Ruiz J, Rossolini GM, et al. Plasmid-mediated quinolone resistance genes in enteroaggregative Escherichia coli from infants in Lima, Peru. Int J Antimicrob Agents. 2012;39:540–2. doi: 10.1016/j.ijantimicag.2012.02.008. [DOI] [PubMed] [Google Scholar]
- 41.Franz E, Veenman C, Van Hoek AH, de Roda Husman A, Blaak H. Pathogenic Escherichia coli producing Extended-Spectrum β-Lactamases isolated from surface water and wastewater. Sci Rep. 2015;5:14372. doi: 10.1038/srep14372. [DOI] [PMC free article] [PubMed] [Google Scholar]