Skip to main content
. 2019 Oct 31;9:15747. doi: 10.1038/s41598-019-52345-9

Table 1.

Oligonucleotides used for CDV P gene detection and for full length H gene and Fsp-coding region amplification and sequencing.

Oligonucleotide label Oligonucleotide sequence Genomic position* Reference
Amplification of P gene
CDV Universal (forward) ATGTTTATGATCACAGCGGT 2132–2151 Daly et al., 2006
CDV Universal (reverse) ATTGGGTTGCACCACTTGTC 2541–2560 Daly et al., 2006
Amplification and sequencing of H gene
CDVff1 (forward) TCGAAATCCTATGTGAGATCACT 6897–6919 Lan et al.32
CDVHS2 (reverse) ATGCTGGAGATGGTTTAATTCAATCG 8994–8969 Lan et al.32
CDVHS1 (forward) AACTTAGGGCTCAGGTAGTCC 7054–7074 Lan et al.32
CDVHforD (forward) GACACTGGCTTCCTTGTGTGTAG 7948–7970 Lan et al.32
CDVHr2 (reverse) GTTCTTCTTGTTTCTCAGAGG 8198–8178 Lan et al.32
CDVP2F (forward) ACTTCCGCGATCTCCACT 7372–7389 Pardo et al.33
CDVP3R (reverse) ACACTCCGTCTGAGATAGC 7760–7742 Pardo et al.33
CDVP5R (reverse) GTGAACTGGTCTCCTCTA 8395–8378 Pardo et al.33
Amplification and sequencing of Fsp-coding region
F5 (forward) TGTTACCCGCTCATGGAGAT 4272–4292 Riley and Wilkes, 2015
R5 (reverse) CCAAGTACTGGTGACTGGGTCT 5411–5433 Riley and Wilkes, 2015
CDV-F4854 (Forward) TCCAGGACATAGCAAGCCAACA 4854–4875 Sarute et al., 2013
CDV-R5535 (Reverse) GGTTGATTGGTTCGAGGACTGAA 5513–5535 Sarute et al., 2013

*Reference genome AF164967 (A75/17).