Table 1.
Mutation | Splicing pattern | HSF consensus value | |
---|---|---|---|
Donor | Acceptor | ||
Wild type | AGTGGAGGAGGGTGTTCCTC | 95.15 | 93.97 |
Mutant 1 | TTACTTGAAGGGTGTTCCTC | 75.99 | 93.97 |
Mutant 2 | CAGAGGCTAGTTGTCTTGCT | 69.25 | 77.29 |
TTACTTGAAGGGTGTTCCTC | 75.99 | 93.97 | |
Mutant 3 | CAGAGGCTAGTTGTCTTGCT | 69.25 | 77.29 |
AATTTAAGTAGGTGTTCCTC | NA | 93.97 | |
Mutant 4 | CAGAGGCTAGGGTGTTCCTC | 69.25 | 93.97 |
Exon sequences in wild‐type and mutant tissues are shown in capital letters, with intron sequences in lower case. Acceptor and donor ends are shown in bold, and the corresponding sequence being spliced out is boxed.