| Human_ATXN3_ Forward RT Primer (GCACGTTTTTACAGCAGCCTT) | This study (RT–PCR) |
| Human_ATXN3_ Reverse RT Primer (AGCCTCTGATACTCTGGACTGT) | This study (RT–PCR) |
| Human_RNF8_ Forward RT Primer_P1 (TTGAGGCTGTCACCTTGAACT) | This study (RT–PCR) |
| Human_ RNF8_ Reverse RT Primer_P1 (TGTCCTTCCGACAAATGGGG) | This study (RT–PCR) |
| Human_ RNF8_ Forward RT Primer_P2 (TCGCAGCAAGAAGGACTTTGA) | This study (RT–PCR) |
| Human_ RNF8_ Forward RT Primer_P2 (AGTTCAAGGTGACAGCCTCAAT) | This study (RT–PCR) |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.