| Cat # | Sequence | |
| Flexitube siRNA PROM1 1 | SI00083741 | CACGTTATAGTCCATGGTCCA |
| Flexitube siRNA PROM1 2 | SI00083748 | CAGGTAAGAACCCGGATCAAA |
| Flexitube siRNA PROM1 3 | SI00083755 | ACCTTTGAGTTTGGTCCCTAA |
| Flexitube siRNA PROM1 4 | SI03098263 | CTGGCTAAGTACTATCGTCGA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.