Table 1.

Sequences of the RT-ShDra1-RPA primers (forward and reverse) and the internal probe together with a description of the specific probe design for the assay

Primer/probe	Sequence (5′–3′)
Forward	ATCTCACCTATCAGACGAAACAAAGAAAAT
Reverse	AATATGAAACAATTTTCACAACGATACGAC
Probe	AATTGTTGGTGGAAGTGCCTGTTTCGCAA(FAM)(THF)(Q)CTCCGGAATGGTTG(C3) (46–52 bp long, 30 bp between 5′-end and THF with a minimum of 15 bp between the THF and the 3′-end of the probe; THF, a basic tetrahydrofuran residue or dSpacer (replaces any bp between the FAM and Q; C3, spacer at the 3’-end; Q, Quencher replaces a T; FAM, replaces a T)