Table 1.
Synthetic DNA oligo used in this research
| Oligo name | Sequence (5`- 3`) | Application |
|---|---|---|
| GmNHX1-F | acgttgcacgggatcccccttcatgccatgggaca | Construction of TRV induced GmNHX1 silencing vector. |
| GmNHX1-R | ctagctagggggtacctccagaggaccaacatccaac | |
| RT GmNHX1 F | actgcgaagcaatgcaatca | Detection of transcriptional level of GmNHX1 and using RT-PCR. |
| RT GmNHX1 R | ggccattacgttcagttggtg | |
| RT ACTIN F | atggctgatggtgaagacattc | |
| RT ACTIN R | tccatgctcaatagggtacttg | |
| OE GmNHX1 F | ggtaccatggtttttgaaatcagttc | Construction of binary vector pCAMBIA1300-GmNHX1. |
| OE GmNHX1 R | tctagatcaacgccattgatggcca | |
| GFP GmNHX1 F | tgcccatgggacaaaatggtttttgaaatc | Construction of GFP fused vector pCAMBIA1300-GmNHX1-GFP. |
| GFP GmNHX1 R | cgccccgggacgccattgatgg | |
| qRT AtSKOR F | accgaaacaaactcggtaggaa | Detection of transcriptional level of salt stress related genes using RT-qPCR. |
| qRT AtSKOR R | ttagcacggatagagacaggaatg | |
| qRT AtSOS1 F | gtgaagcaatcaagcggaaa | |
| qRT AtSOS1 R | tgcgaagaaggcgtagaaca | |
| qRT AtHKT1 F | gatttgtccccacgaatgaga | |
| qRT AtHKT1 R | caaaaccaagaagcaagggaac | |
| qRT AtAKT1 F | aaaggtctcactcatcaacaacga | |
| qRT AtAKT1 R | tcggcaaaagaggcaaaataag | |
| qRT ACTIN F | gcaccgccagagagaaaatac | |
| qRT ACTIN R | caccaccacgaaccagataaga |