Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene(Tribolium castaneum) | foxQ2 | iBeetle-Base http://ibeetle-base.uni-goettingen.de/ | TC004761 | Drosophila Ortholog: fd102, CG11152 |
| Strain, strain background (Tribolium castaneum) | San Bernardino | SB | NCBI:txid7070 | |
| Strain, strain background (Tribolium castaneum) | vermillionwhite | vw | NCBI:txid7070 for transgenesis, mutant eye color (white) is rescued to black by 3XP3-vw |
|
| Genetic reagent (Tribolium castaneum) | foxQ2-5’-line | this publication | marks Tc-foxQ2 positive cells with EGFP; maintained by Bucher-Lab |
|
| Genetic reagent (Tribolium castaneum) | Ten-a-green-line | this publication | marks Ten-a positive cells with EGFP; maintained by Bucher-Lab | |
| Genetic reagent (Tribolium castaneum) | rx-5’-up-line | this publication | marks a subset of Tc-rx positive cells with dsRedexpress; maintained by Bucher-Lab | |
| Recombinant DNA reagent | [3xP3:Tc’v-SV40-Cre-2A-EGFP:bhsp68-eb] | this publication Addgene plasmid #124068 |
repair template for NHEJ mediated enhancer traps in Tribolium castaneum
EGFP and Cre under the control of the Tribolium core heat-shock promoter, which is not heat-shock responsive but takes up enhancer traps. |
|
| Recombinant DNA reagent | bhsp68-Cas9 |
Gilles et al., 2015
Addgene plasmid #65959 |
Cas9 gene for co-injection | |
| Antibody | anti-GFP (chicken polyclonal) | Abcam | RRID:AB_300798 | 1:1000 |
| Antibody | anti-acetylated Tubulin (mouse monogclonal) |
Sigma Aldrich | RRID:AB_609894 | 1:50 |
| Antibody | anti-SYNORF1 (synonym: anti synapsin) (mouse monoclonal) |
DHSB Hybridoma Bank (University of Iowa) | RRID:AB_2313867
3C11 (DSHB ID) |
1:40 |
| Antibody | anti-RFP (rabbit polyclonal) | Abcam, ab62341 | RRID: AB_945213 | 1:1000 |
| Antibody | anti-Tenascin (Teneurin)-a (rabbit polyclonal) | Fascetti and Baumgartner, 2002 | 1:1000 | |
| Antibody | Secondary antibodies coupled with Alexa Fluor 488 or Alexa Fluor 555 (goat anti mouse or goat anti chicken, polyclonal) |
Thermo Fisher Scientific Cat # A32723 Cat # A32727 Cat # A-11039 Cat # A-21437 |
RRID:AB_2633275
RRID:AB_2633276 RRID:AB_142924 RRID:AB_2535858 |
1:1000. |
| Commercial assay or kit | MEGAscript T7 Transcription Kit | Thermo Fisher Scientific | production of dsRNA | |
| Sequence-based reagent | Tc-foxQ2RNAi_a-L | Kitzmann et al., 2017 | Primer for dsRNA template production: GAATTGTAATACGACTCAC TATAGGCTTACTTCAGGACCCGG |
|
| Sequence-based reagent | Tc-foxQ2RNAi_a-R | Kitzmann et al., 2017 | Primer for dsRNA template production: GAATTGTAATACGACTCACTATAGGTCGCTTGTAACAATGCTTGA |