Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Drosophila melanogaster) | Mi1 >> GCaMP6f | Bloomington Drosophila Stock Center | w+; R19F01-p65ADZpattP40 / +; R71D01-ZpGdbdattP2/UAS-GCaMP6f | Figures 1, 2 and 7 Figure 2—figure supplement 1 |
| Strain, strain background (Drosophila melanogaster) | Tm3 >> GCaMP6f | Bloomington Drosophila Stock Center | w+; R38C11-p65ADZpattP40 / +; R59C10-ZpGdbdattP2/UAS- GCaMP6f | Figures 1, 2 and 7 Figure 2—figure supplement 1 |
| Strain, strain background (Drosophila melanogaster) | L1 >> GCaMP6f | Bloomington Drosophila Stock Center | w+; L1[c202]-Gal4 / +; UAS-GCaMP6f / + | Figure 1, 2 |
| Strain, strain background (Drosophila melanogaster) | Mi1 >> iGluSnFR | Bloomington Drosophila Stock Center | w+; R19F01-p65ADZpattP40 / +; R71D01-ZpGdbdattP2/UAS iGluSnFR A184A attP2 | Figure 1, Figure 2—figure supplement 3 |
| Strain, strain background (Drosophila melanogaster) | Tm3 >> iGluSnFR | Bloomington Drosophila Stock Center | w+; R38C11-p65ADZp[attP40] / +; R59C10-ZpGdbdattP2/UAS iGluSnFR A184AattP2 | Figure 1, Figure 2—figure supplement 3 |
| Strain, strain background (Drosophila melanogaster) | T4/T5 >> GCaMP6f | Bloomington Drosophila Stock Center | w+; R64G09-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; + / + | Figure 2, Figure 8 |
| Strain, strain background (Drosophila melanogaster) | GluClα MI02890-GFSTF.2 | Bloomington Drosophila Stock Center | y1 w*; Mi{PT-GFSTF.2} GluClα MI02890-GFSTF.2/TM6C, Sb1 Tb1 | Figure 3 |
| Antibody | Anti-GFP (chicken polyclonal) | Abcam | Cat# ab13970, RRID:AB_300798 |
IF (1:2000) Figure 3, Figure 4—figure supplement 2 |
| Antibody | Anti-Bruchpilot (mouse monoclonal nc82) | DSHB | Cat# nc82, RRID:AB_2314866 | IF (1:25) Figure 3 |
| Antibody | Alexa Fluor 488-conjugates AffinityPure Goat Anti-Chicken IgG | Jackson ImmunoResearch Labs | Cat# 103-545-155, RRID:AB_2337390 |
IF (1:200) Figure 3 |
| Antibody | Alexa Fluor 594-conjugates AffinityPure Goat Anti-Mouse IgG | Jackson ImmunoResearch Labs | Cat# 115-585-206, RRID:AB_2338886 |
IF (1:200) Figure 3 |
| Strain, strain background (Drosophila melanogaster) | Mi1 >> GCaMP6f, Rdl1/+ control | Bloomington Drosophila Stock Center | w +; R19F01-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; Rdl1 / + | Figure 4, Figure 4—figure supplement 1 |
| Strain, strain background (Drosophila melanogaster) | Tm3 >> GCaMP6f, +/+ control | Bloomington Drosophila Stock Center | w +; R13E12-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; + / + | Figure 4, Figure 4—figure supplement 1 |
| Strain, strain background (Drosophila melanogaster) | Mi1 >> GCaMP6f, Rdl1/RdlMDMD-RR * | Bloomington Drosophila Stock Center | w +; R19F01-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; Rdl1/RdlMDMD-RR | Figure 4, Figure 4—figure supplement 1 |
| Strain, strain background (Drosophila melanogaster) | Tm3 >> GCaMP6f,RdlMD-RR/RdlMDMD-RR * | Bloomington Drosophila Stock Center | w +; R13E12-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; RdlMD-RR/RdlMDMD-RR | Figure 4, Figure 4—figure supplement 1 |
| Strain, strain background (Drosophila melanogaster) | C2,C3 >> GFP | Bloomington Drosophila Stock Center | w+/UAS-CD8::GFP; R20C11 -p65ADZpattP40/UAS-2xEGFP; R48D11-ZpGdbdattP2/+ | Figure 4—figure supplement 2 |
| Strain, strain background (Drosophila melanogaster) | L1 >> GFP | Bloomington Drosophila Stock Center | w+/UAS-CD8::GFP; L1[c202]-Gal4/UAS-2xEGFP; + / + | Figure 4—figure supplement 2 |
| Antibody | Anti-GABA (rabbit polyclonal) | Sigma-Aldrich | Cat# A2052, RRID:AB_477652 | IF (1:200) Figure 4—figure supplement 2 |
| Antibody | Alexa Fluor 594-conjugates AffiniPure Goat Anti-Rabbit IgG | Jackson ImmunoResearch Labs | Cat# 111-585-003, RRID:AB_2338059 | IF (1:200) Figure 6 |
| Strain, strain background (Drosophila melanogaster) | Mi1 >> GCaMP6f, GluClαDf/+ control | Bloomington Drosophila Stock Center | w +; R19F01-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; Df(3R)ED6025/ + | Figure 6, Figure 6—figure supplement 1 |
| Strain, strain background (Drosophila melanogaster) | Tm3 >> GCaMP6f, GluClαDf/+ control | Bloomington Drosophila Stock Center | w +; R13E12-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; Df(3R)ED6025/ + | Figure 6, Figure 6—figure supplement 1 |
| Strain, strain background (Drosophila melanogaster) | Mi1 >> GCaMP6f, GluClαS278T/GluClαDf | This paper | w +; R19F01-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; Df(3R)ED6025/GluClαS278T |
Figure 6, Figure 6—figure supplement 1
More information in the Materials and methods section under ‘Molecular biology’ |
| Strain, strain background (Drosophila melanogaster) | Tm3 >> GCaMP6f, GluClαS278T/GluClαDf | This paper | w +; R13E12-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; ; Df(3R)ED6025/GluClαS278T |
Figure 6, Figure 6—figure supplement 1
More information in the Materials and methods section under ‘Molecular biology’ |
| Strain, strain background (Drosophila melanogaster) | T4/T5 >> GCaMP6f, GluClαDf/+ control | Bloomington Drosophila Stock Center | w+; R64G09-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; ; Df(3R)ED6025 / + | Figure 6, Figure 6—figure supplement 1 |
| Strain, strain background (Drosophila melanogaster) | T4/T5 >> GCaMP6f, GluClαS278T/GluClαDf | This paper | w+; R64G09-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / + ; Df(3R)ED6025/GluClαS278T CRISPR |
Figure 6, Figure 6—figure supplement 1
More information in the Materials and methods section under ‘Molecular biology’ |
| Strain, strain background (Drosophila melanogaster) | Mi1 >> Flp,GCaMP6f; GluClαFlpStop.ND/GluClαDf | This paper | w+; R19F01-p65ADZpattP40/UAS-GCaMP6f, UAS-Flp; R71D01-ZpGdbdattP2, GluClαDf/GluClαFlpStop.ND |
Figure 7
More information in the Materials and methods section under ‘Generation of transgenic lines’ |
| Strain, strain background (Drosophila melanogaster) | Mi1 >> Flp,GCaMP6f; GluClαFlpStop.ND / +(Heterozygous control) | This paper | w+; R19F01-p65ADZpattP40/UAS-GCaMP6f, UAS-Flp; R71D01-ZpGdbdattP2/GluClαFlpStop.ND |
Figure 7
More information in the Materials and methods section under‘Generation of transgenic lines’ |
| Strain, strain background (Drosophila melanogaster) | Mi1 >> GCaMP6f; GluClαFlpStop.ND/GluClαDf(No Flp control) | This paper | w+; R19F01-p65ADZpattP40/UAS-GCaMP6f; R71D01-ZpGdbdattP2, GluClαDf / ; GluClαFlpStop.ND |
Figure 7
More information in the Materials and methods section under‘Generation of transgenic lines’ |
| Strain, strain background (Drosophila melanogaster) | Mi1 >> GCaMP6f, GluClαdsRNA | Bloomington Drosophila Stock Center | w+; R19F01-p65ADZpattP40/P{y[+t7.7] v[+t1.8]=TRiP.HMC03585}attP40; R71D01-ZpGdbdattP2/UAS-GCaMP6f | Figure 7 |
| Strain, strain background (Drosophila melanogaster) | Tm3 >> GCaMP6f, GluClαdsRNA | Bloomington Drosophila Stock Center | w+; R38C11-p65ADZpattP40/P{y[+t7.7] v[+t1.8]=TRiP.HMC03585}attP40; R59C10-ZpGdbdattP2/UAS-GCaMP6f | Figure 7 |
| Strain, strain background (Drosophila melanogaster) | Mi1 >> GCaMP6f, GluClαFlpStop.D / + | This paper | w +; R19F01-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; GluClαFlpStop.D / + |
Figure 7
More information in the Materials and methods section under‘Generation of transgenic lines’ |
| Strain, strain background (Drosophila melanogaster) | Mi1 >> GCaMP6f, GluClαDf / + | Bloomington Drosophila Stock Center | w +; R19F01-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; ; Df(3R)ED6025/GluClαWT | Figure 7 |
| Strain, strain background (Drosophila melanogaster) | Mi1 >> GCaMP6f, GluClαFlpStop.D/GluClαDf ** | This paper | w +; R19F01-LexA}attP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; ; Df(3R)ED6025/GluClαFlpStop.D |
Figure 7
More information in the Materials and methods section under‘Generation of transgenic lines’ |
| Strain, strain background (Drosophila melanogaster) | Tm3 >> GCaMP6f, GluClαFlpStop.D / + | This paper | w +; R13E12-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; GluClαFlpStop.D / +T |
Figure 7
More information in the Materials and methods section under‘Generation of transgenic lines’ |
| Strain, strain background (Drosophila melanogaster) | Tm3 >> GCaMP6f, GluClαDf / + | Bloomington Drosophila Stock Center | w +; R13E12-lexA}attP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; ; Df(3R)ED6025/ + | Figure 7 |
| Strain, strain background (Drosophila melanogaster) | Tm3 >> GCaMP6f, GluClαFlpStop.D/GluClαDf ** | This paper | w +; R13E12-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; ; Df(3R)ED6025/GluClαFlpStop.D |
Figure 7
More information in the Materials and methods section under‘Generation of transgenic lines’ |
| Strain, strain background (Drosophila melanogaster) | T4/T5 >> GCaMP6f, GluClαFlpStop.D / + | This paper | w+; R64G09-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; GluClαFlpStop.D / + |
Figure 8
More information in the Materials and methods section under ‘Generation of transgenic lines’ |
| Strain, strain background (Drosophila melanogaster) | T4/T5 >> GCaMP6f, GluClαDf / + | Bloomington Drosophila Stock Center | w+; R64G09-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; ; Df(3R)ED6025/ + | Figure 8 |
| Strain, strain background (Drosophila melanogaster) | T4/T5 >> GCaMP6f, GluClαFlpStop.D/GluClαDf ** | This paper | w+; R64G09-LexAattP40, lexAop2-IVS-GCaMP6f-p10su(Hw)attP5 / +; ; Df(3R)ED6025/GluClαFlpStop.D |
Figure 8
More information in the Materials and methods section under ‘Generation of transgenic lines’ |
| Chemical compound, drug | Picrotoxin | Sigma Aldrich | P1675_SIGMA |
Figures 2, 4, 5 and 6
Figure 2—figure supplements 2 and 3, Figure 4—figure supplement 1, Figure 6—figure supplement 1 |
| Chemical compound, drug | MPEP | Abcam | Ab120008 | Figure 2—figure supplement 1 |
| Sequence-based reagent | GluCla_forward | This paper | ACCAAACTGCTGCAAGAC |
qRT-PCR
Figure 7 More information in the Materials and methods section under ‘Molecular biology’ |
| Sequence-based reagent | GluCla_reverse | This paper | GATATGTGCTCCAGTAGACC |
qRT-PCR
Figure 7 More information in the Materials and methods section under ‘Molecular biology’ |
| Sequence-based reagent | GAPDH2_forward | This paper | GATGAGGAGGTCGTTTCTAC |
qRT-PCR
Figure 7 More information in the Materials and methods section under ‘Molecular biology’ |
| Sequence-based reagent | GAPDH2_reverse | This paper | GTACTTGATCAGGTCGATG |
qRT-PCR
Figure 7 More information in the Materials and methods section under ‘Molecular biology’ |
| Software, algorithm | MATLAB R2017a | The MathWorks Inc.50 Natick, MA | Custom scripts | Codes are available in the Source code 1 |
*We used different allelic combinations for the RdlMDRR insensitive allele when imaging Mi1 (RdlMD-RR/Rdl1) or Tm3 (RdlMD-RR/RdlMDMD-RR). While the use of the Rdl1 null mutant is genetically cleaner, application of low concentrations of PTX has weaker phenotypes in genetic backgrounds carrying the Rdl1 allele than in wild type, possibly due to homeostatic mechanisms (Figure 2A,B, Figure 4A). The 2.5 µM PTX phenotype was even weaker in Tm3, and did not leave a margin to look for rescue by RdlMDRR, which is why we instead used two copies of the RdlMDRR allele, which has a PTX phenotype similar to wild type in heterozygosity.
**GluClαFlpStop.D/Df mutant larvae failed to crawl out of the food, but adult flies could be obtained after saving pupae from the food.