KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Armenian Hamster Anti-Mouse CD3e ePluor® 450 | Thermo Fisher Scientific | Cat #48-0031-80; RRID: AB_10733280 |
| Rat Anti-Human/Mouse CD45R (B220) eFluor® 450 | Thermo Fisher Scientific | Cat #48-0452-80; RRID: AB_1548763 |
| Rat Anti-Mouse TER-119 eFluor® 450 | Thermo Fisher Scientific | Cat #48-5921-80; RRID: AB_1518809 |
| Rat Anti-Mouse Ly-6G/Ly-6C (Gr-1) eFluor® 450 | Thermo Fisher Scientific | Cat #48-5931-82; RRID: AB_1548788 |
| Rat Anti-Mouse/Human CD11b APC-Cy7 | Biolegend | Cat#101226; RRID: AB_830642 |
| Rat Anti-Mouse Ly-6A/E (Sca-1) PE-Cy7 | Biolegend | Cat#108114; RRID: AB_493596 |
| Rat Anti-Mouse CD117 (c-Kit) APC | BD Biosciences | Cat #553356; RRID: AB_398536 |
| Armenian Hamster Anti-Mouse CD48 PITC | Biolegend | Cat#103404; RRID: AB_313019 |
| Rat Anti-Mouse CD150 (SLAM) Brilliant Violet 510 | Biolegend | Cat#115929; RRID: AB_2562189 |
| Rat Anti-Mouse CD16/CD32 (Mouse BD PC Block) | BD Biosciences | Cat #553142; RRID: AB_394657 |
| Rat Anti-Mouse CD3 antibody PE-Cy7 | Biolegend | Cat#100220; RRID: AB_1732057 |
| Rat Anti-Human/Mouse CD45R (B220) PITC | Thermo Fisher Scientific | Cat #11-0452-85; RRID: AB_465055 |
| Rat Anti-Mouse Ly-6G/Ly-6C (Gr-1)Biotin | Biolegend | Cat #108404; RRID: AB_313369 |
| Mouse Anti-Mouse CD45.1 Pacific Blue | Biolegend | Cat #110722; RRID: AB_492866 |
| Mouse Anti-Mouse CD45.2 APC | Biolegend | Cat#109814; RRID: AB_389211 |
| Rat Anti-Mouse Lineage Cocktail Pacific Blue | Biolegend | Cat#133310; RRID: AB_11150779 |
| Mouse Anti-Mouse CD45.2 Alexa Fluor® 700 | Biolegend | Cat #109822; RRID: AB_493731 |
| Rat Anti-Mouse TER-119 APC | Biolegend | Cat#116212; RRID: AB_313713 |
| Rat Anti-Mouse CD71 PITC | BD Biosciences | Cat #553266; RRID: AB_394743 |
| Armenian Hamster Anti-Mouse CD3e Biotin | Biolegend | Cat#100304; RRID: AB_312669 |
| Rat Anti-Human/Mouse CD45R (B220) Biotin | Thermo Fisher Scientific | Cat #13-0452-82; RRID: AB_466449 |
| Rat Anti-Mouse CD19 Biotin | Biolegend | Cat #115504; RRID: AB_313639 |
| Rat Anti-Mouse TER-119 Biotin | Biolegend | Cat#116204; RRID: AB_313705 |
| Rat Anti-Mouse Ly-6G/Ly-6C (Gr-1)Biotin | Biolegend | Cat #108404; RRID: AB_313369 |
| eBioscience Streptavidin ePluor450 | Thermo Fisher Scientific | Cat #48-4317-82; RRID: AB_10359737 |
| Rat Anti-Mouse CD34 PITC | Thermo Fisher Scientific | Cat #11-0341-85; RRID: AB_465022 |
| Rat Anti-Mouse CD16/CD32 Alexa Fluor® 700 | Thermo Fisher Scientific | Cat #56-0161-82; RRID: AB_493994 |
| Rat Anti-Mouse/Human CD11b APC | Biolegend | Cat#101212; RRID: AB_312795 |
| Rat Anti-Mouse Ly-6G Pacific Blue | Biolegend | Cat#127612; RRID: AB_2251161 |
| Rat Anti-Mouse Ly-6A/E (Sca-1) APC | Biolegend | Cat#108112; RRID: AB_313349 |
| Rat Anti-Mouse CD45 APC-Cy7 | BD Biosciences | Cat #557659; RRID: AB_396774 |
| Rat Anti-Mouse CD11b APC-Cy7 | BD Biosciences | Cat #557657; RRID: AB_396772 |
| Rat Anti-Mouse Ter-119 APC-Cy7 | Biolegend | Cat#116223; RRID: AB_2137788 |
| Rat Anti-Mouse Ly-6A/E (Sca-1) APC | Thermo Fisher Scientific | Cat #17-5981-82; RRID: AB_469487 |
| Hamster Anti-Mouse/Rat CD29 (β1-integrin) PITC | Biolegend | Cat#102206; RRID: AB_312883 |
| Rat Anti-Mouse CD184 (CXCR4) Biotin | BD Biosciences | Cat #551968; RRID: AB_394307 |
| Anti-Myosin (Skeletal, Past) antibody | Millipore Sigma | Cat #M4276; RRID: AB_477190 |
| Anti-Myosin (Skeletal, Slow) antibody | Millipore Sigma | Cat #M8421; RRID: AB_477248 |
| Mouse Anti-Pax7 antibody | Developmental Studies Hybridoma Bank | Cat #AB_528428; RRID: AB_528428 |
| Rabbit Anti-Laminin antibody | Millipore Sigma | Cat #AB2034; RRID: AB_91209 |
| Goat Anti-mouse IgG1, Alexa Fluor 488 | Thermo Fisher Scientific | Cat #A-21121; RRID: AB_2535764 |
| Goat Anti-rabbit IgG (H+L), Alexa Fluor 647 | Thermo Fisher Scientific | Cat #A-21244; RRID: AB_2535812 |
| Mouse on Mouse (M.O.M.™) Basic Kit | Vector Laboratories | Cat #BMK-2202; RRID: AB_2336833 |
| Streptavidin-PE-Cy7 | BD Biosciences | Cat #557598; RRID: AB_I0049577 |
| CD45-ePluor450 | Thermo Fisher Scientific | Cat #48-0451-82; RRID: AB_1518806 |
| CD140a (PDGPRa) -biotin | Thermo Fisher Scientific | Cat #13-1401-82; RRID: AB_466607 |
| CD24-PITC | Thermo Fisher Scientific | Cat #11-0242-82; RRID: AB_464988 |
| Sca-1-PerCP-Cy5.5 | Thermo Fisher Scientific | Cat #45-5981-82; RRID: AB_914372 |
| Goat anti-mouse CD140a (PDGPRa) | R&D systems | Cat #AP1062-SP; RRID: AB_2236897 |
| Rabbit anti-RPP | Rockland | Cat #600-401-379; RRID: AB_2209751 |
| Alexa Fluor 488 Affinipure Donkey anti-goat IgG | Jackson Immunoresearch | Cat #705-545-147; RRID: AB_2336933 |
| Cy ™ 3 Affinipure Donkey anti-rabbit IgG | Jackson Immunoresearch | Cat #711-165-152; RRID: AB_2307443 |
| 4’,6-diamino-2-phenyNndole (DAPI) | Thermo Fisher Scientific | Cat #D1306; RRID: AB_2629482 |
| SYTOX Blue Dead Cell Stain, for flow cytometry | Thermo Fisher Scientific | Cat #S34857 |
| 7-AAD | BD Biosciences | Cat #559925 |
| Streptavidin, Pacific Orange conjugate | Thermo Fisher Scientific | Cat #S32365 |
| Anti-APC Microbeads | Miltenyi Biotec | Cat#120-001-265 |
| Wheat Germ Agglutinin, Alexa Fluor 488 Conjugate | Thermo Fisher Scientific | Cat#W11261 |
| Propidium Iodide | Millipore Sigma | Cat#P4170-25MG |
| Calcein Blue, AM | Thermo Fisher Scientific | Cat#C1429 |
| eBioscience™ Streptavidin-APC | Thermo Fisher Scientific | Cat#17-4317-82 |
| Bacterial and Virus Strains | ||
| ElectroMAX™ Stbl4™ Competent Cells | Thermo Fisher Scientific | Cat#11635018 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| HBSS, calcium, magnesium, no phenol red | Thermo Fisher Scientific | Cat#14025-134 |
| PBS (for cell culture) | GE Healthcare (Hyclone) | Cat#SH30071.03 |
| PBS (for staining media) | Millipore Sigma | Cat#P6178-500mL |
| Dulbecco’s Phosphate-Buffered Saline (DPBS), no calcium, no magnesium | Thermo Fisher Scientific | Cat#14190-250 |
| Collagen I Rat Protein | Thermo Fisher Scientific | Cat#A1048301 |
| Natural Mouse Laminin, 1mg | Thermo Fisher Scientific | Cat#23017015 |
| PGP-Basic, recombinant | Millipore Sigma | Cat #P0291 |
| DMEM, high glucose | Thermo Fisher Scientific | Cat#11965118 |
| Ham’s P10 Nutrient Mix, 500ml bottle | Thermo Fisher Scientific | Cat#11550043 |
| Donor Horse Serum | Atlanta Biologicals | Cat#S12150 |
| Penicillin-Streptomycin | Thermo Fisher Scientific | Cat#15140122 |
| GlutaMAX Supplement | Thermo Fisher Scientific | Cat#35050061 |
| Dexamethasone | Millipore Sigma | Cat#D1756 |
| Insulin solution from bovine pancreas | Millipore Sigma | Cat#I0516 |
| Rosiglitazone | Cayman Chemical | Cat#71740 |
| 3-isobutyl-1-methylxanthine | Millipore Sigma | Cat #I5879 |
| Paraformaldehyde, 32% solution | VWR | Cat#100496-496 |
| Triton X-100 | Millipore Sigma | Cat #T9284 |
| Triton X-100 | Thermo Fisher Scientific | Cat#BP151 |
| Normal Goat Serum, Jackson Immuno | VWR | Cat#102643-594 |
| Donkey Serum | Millipore Sigma | Cat #D9663 |
| Bovine Serum Albumin (BSA) | Millipore Sigma | Cat #A9647 |
| Bovine Serum Albumin (BSA) | Millipore Sigma | Cat #A7030 |
| Gelatin from cold water fish skin | Millipore Sigma | Cat #G7765 |
| Tween 20 | Millipore Sigma | Cat #P1379 |
| BODIPY™ 493/503 | Thermo Fisher Scientific | Cat #D3922 |
| Hoechst 33342, Trihydrochloride, Trihydrate | Thermo Fisher Scientific | Cat #H1399 |
| Cardiotoxin gamma from Naja pallida | Latoxin | Cat #L8102 |
| EDTA (0.5M), pH 8.0 | Thermo Fisher Scientific | Cat #AM9261 |
| Dextran | Millipore Sigma | Cat #31392 |
| ACK Lysing Buffer | Thermo Fisher Scientific | Cat #A1049201 |
| Iodixanol | Axis-Shield PoC AS | Cat #AXS-1114542-5 |
| Trizol LS | Thermo Fisher Scientific | Cat #1029610 |
| Isopentane (2-Methylbutane) | Millipore Sigma | Cat #M32631 |
| Paraformaldehyde (PPA), 32% solution, EM grade | VWR | Cat #100496-496 |
| Vectashield HardSet Antifade Mounting Medium with DAPI | Vector Laboratories | Cat #H-1200 |
| Critical Commercial Assays | ||
| SuperScript IV VILO Master Mix with ezDNase Enzyme | Thermo Fisher Scientific | Cat #11766050 |
| Pax7 TaqMan assay | Thermo Fisher Scientific | Mm01354484_m1 |
| Myf5 TaqMan assay | Thermo Fisher Scientific | Mm00435125_m1 |
| Myod1 TaqMan assay | Thermo Fisher Scientific | Mm00440387_m1 |
| Myog TaqMan assay | Thermo Fisher Scientific | Mm00446194_m1 |
| Gapdh TaqMan assay | Thermo Fisher Scientific | Mm99999915_g1 |
| TaqMan Past Advanced Master Mix | Thermo Fisher Scientific | Cat #4444557 |
| Experimental Models: Cell Lines | ||
| HEK293 | ATCC | Cat #CRL-1573; RRID: CVCL_0045 |
| Experimental Models: Organisms/Strains | ||
| Mouse: C57B/10ScSn-Dmdmdx/J | The Jackson Laboratory | JAX: 001801; RRID: IMSR_JAX:001801 |
| Mouse: B6;129S6-Gt(ROSA)26Sortm9 (CAG-tdTomato)Hze/J | The Jackson Laboratory | JAX: 007905; RRID: IMSR_JAX:007905 |
| Mouse: B6.Cg-Tg(Pax7-ZsGreen)1Kyba/J | The Jackson Laboratory | JAX: 029549; RRID: IMSR_JAX:029549 |
| Mouse: B6.SJL-Ptprca Pepcb/BoyJ | The Jackson Laboratory | JAX: 002014; RRID: IMSR_JAX:002014 |
| Mouse: C57BL/6J | The Jackson Laboratory | JAX: 000664; RRID: IMSR_JAX:000664 |
| Oligonucleotides | ||
| Pax7_zsGreen_F; CTGCATGTACCACGAGTCCA | N/A | |
| Pax7_zsGreen_R; GTCAGGTGCCACTTCTGGTT | N/A | |
| tdTomato_WT_F; AAGGGAGCTGCAGTGGAGTA | N/A | |
| tdTomato_WT_R; CCGAAAATCTGTGGGAAGTC | N/A | |
| tdTomato_Knock-in_F; CTGTTCCTGTACGGCATGG | N/A | |
| tdTomato_Knock-in_R; GGCATTAAAGCAGCGTATCC | N/A | |
| Recombinant DNA | ||
| Package plasmid (pAAV2/Anc80) L65AAP) | Addgene | Cat #92307 |
| Transgene plasmid (pAAV Cre) | GTVC | In house production |
| pAAV-Cre control plasmid | Cell Biolabs | AAV-401 |
| Helper plasmid (ΔP6) | GTVC | In house production |
| Package plasmid (pKAAV2/8, pKAAV2/9) | GTVC | In house production |
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
| Software and Algorithms | ||
| BD PACSDiva™ Software v8.0.2 | BD Biosciences |
http://www.bdbiosciences.com/us/instruments/research/software/flow-cytometry-acquisition/bd-facsdiva-software/m/111112/overview
; RRID: SCR_001456 |
| FlowJo v10.1r5 | FlowJo |
https://www.flowjo.com/solutions/flowjo; RRID: SCR_008520 |
| Other | ||
| Covidien Monoject Softpack Insulin Syringe, 1/2mL, 28Gx 1/2” | Covidien | 1188528012 |
| Equisul-SDT® (Sulfadiazine Trimethoprim) | Aurora Pharmaceutical | Cat #28002 |
| Irradiated PicoLab Mouse Diet 20 5058 | LabDiet, St. Louis, MO | Cat #0007689 |
| Irradiated LabDiet Prolab Isopro RMH 3000 5P75 | LabDiet, St. Louis, MO | Cat #0006972 |
| Tissue-Tek® O.C.T. Compound, Sakura® Pinetek | VWR | 25608-930 |