Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2019 Nov 12;10:987. doi: 10.3389/fgene.2019.00987

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

Copyright © 2019 Rockwell and Hongay

This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

PMC Copyright notice

Profilin transcripts have multiple Mettl3 binding sites. PFN1 mRNA, depicted in cartoon form at the top, has Mettl3 binding sites (AAACC) depicted by black boxes in the 3′UTR and 5′UTR. PFN2 mRNA represented as the transcript in the middle of this figure, has Mettl3 binding sites (AAACA) in the 3′UTR, exon 3, intron 1, and intron 2. PFN2 mRNA has additional binding sites in 3′UTR represented by green box (UGUGGACU). chic (Drosophila profilin), depicted as the bottom cartoon in this figure, has a cluster of METTL3 binding sites (GTTCTTATTTCTCCGCCGCTGACGGTG) in intron 3 represented by red box. This cluster, when run through appropriate algorithms, can generate hairpins for complex recognition.