Key Resources Table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Monoclonal Mouse Anti-ZIKV Env | Biofront | Cat# BF-1176-56-100UG; RRID:AB_2687892 |
| Polyclonal Rabbit Anti-Cytokeratin | Dako | Cat# Z0622; RRID:AB_2650434 |
| Vimentin Antibody | Abcam | Cat# ab92547; RRID:AB_10562134 |
| Rat Anti-mouse IFN-γ Monoclonal Antibody | BD Bioscience | Cat# 551216; RRID:AB_394094 |
| Rat Anti-mouse IFN-γ Monoclonal Antibody, Biotinilated | BD Bioscience | Cat# 554410; RRID:AB_395374 |
| Goat Anti-mouse IgA-HRP Antibody | Southern Biothechnology Associates | Cat# 1040-05; RRID:AB_2714213 |
| Rabbit Anti-mouse IgG (H+L) Antibody | Jackson ImmunoResearch Labs | Cat# 315-035-045; RRID:AB_2340066 |
| Bacterial and Virus Strains | ||
| ZIKV-BR; Brazil/ZKV2015, GenBank: KU497555 | Cugola et al., 2016 | N/A |
| Biological Samples | ||
| ZIKV Infected Mouse Tissues | This paper | N/A |
| Uninfected Mouse Tissues | This paper | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| prM, Env, Cap, and NS1 peptide pools | JPT, Germany Abbink et al., 2016 | PepMixes Zika Virus ULTRA |
| MultiScreen HTS Filter Plate | Millipore | Cat# MSIPS4W10 |
| Streptavidin-alkaline Phosphatase | Southern Biotechnology Associates | Cat # 7100-04 |
| 1-Step™ NBT/BCIP Substrate Solution | ThermoFisher Scientific | Cat# 34042 |
| 2-Mercaptoethanol (1,000X), Liquid | ThermoFisher Scientific | Cat# 21985023 |
| TWEEN® 20 | Millipore-Sigma | Cat# P2287-500mL |
| Concanavalin A | Millipore-Sigma | Cat# 5275-5mg |
| MEM Non-Essential Amino Acids Solution | ThermoFisher Scientific | Cat# 11140050 |
| 10% Neutral Buffered Formalin | Millipore-Sigma | Cat# HT501128-4L |
| Xylene | Millipore-Sigma | Cat# 534056 |
| Antigen Unmasking Solution, Citric Acid Based Antibody | Vector Labs | Cat # H-3300; RRID:AB_2336226 |
| Klear Dual Enzyme Block | GBI Labs | Cat# E36-18 |
| Gill’s Hematoxylin | VWR | Cat# 100504-388 |
| Eosin | VWR | Cat # 95057-848 |
| Ethanol 190 Proof | VWR | Cat# 700000-282 |
| Tris Buffered Saline, with Tween® 20, pH 7.5 | Millipore-Sigma | Cat# SRE0031-500ML |
| RPMI | Corning | Cat# 10-047-CV |
| DPBS | ThermoFisher Scientific | Cat# 14190-144 |
| FBS | Millipore-Sigma | Cat# F2442-500ml |
| Pen/Strep | ThermoFisher Scientific | Cat# 10378016 |
| 100x L-glutamine | Lonza | Cat# 17-605E |
| QIAzol Lysis Reagent | Qiagen | Cat# 79306 |
| Isoflurane | Patterson Veterinary Supply | Cat# 1169567762 |
| Critical Commercial Assays | ||
| QIAcube HT | Qiagen | Cat# 9001793 |
| Cador Pathogen 96 QIAcube HT Kit | Qiagen | Cat# 54161 |
| RNeasy 96 QIAcube HT Kit | Qiagen | Cat# 74171 |
| RNA Clean & Concentrator™−5 | Zymo Research | Cat# R1015 |
| Klear Mouse AP with Fast Red Kit | GBI Labs | Cat# D50-18/D50-6 |
| Polink TS-MRR-Ms A Kit | GBI Labs | Cat# TS309A-6 |
| Mouse anti-ZIKV Env ELISA kit | Alpha Diagnostics | Cat# RV-403120-1 |
| Deposited Data | ||
| Experimental Models: Cell Lines | ||
| Vero Cells | World Health Organization, NICSC-011038011038 | N/A |
| Experimental Models: Organisms/Strains | ||
| Balb/cJ Mouse | The Jackson Laboratory | Cat# 000651 |
| C57BL/6J Mouse | The Jackson Laboratory | Cat# 000664 |
| B6.129S2-Ifnar1tm1Agt/Mmjax (IFN-αβR−/−) | the Jackson Laboratory | Cat# 32045-JAX |
| Oligonucleotides | ||
| ZIKV.Cap.RT.probe AGTTCAAGAAAGATCTGGCTG | Larocca et al. 2016 | N/A |
| ZIKV.Cap.RT.fwd GGAAAAAAGAGGCTATGGAAATAATAAAG | Larocca et al. 2016 | N/A |
| ZIKV.Cap.RT.rev CTCCTTCCTAGCATTGATTATTCTCA | Larocca et al. 2016 | N/A |
| Zika virus strain BeH815744, GenBank: KU365780 | Homo sapiens | N/A |
| ZIKV Cap mRNA Standards | Larocca et al., 2016 | N/A |
| Recombinant DNA | ||
| Software and Algorithms | ||
| GraphPad Prism v6.03 | GraphPad Software | www.graphpad.com/ |
| Softmax Pro 6.0 Software | Molecular Devices | www.moleculardevice.com |
| Fuji Synapse PACS 3D Software | FujiFILM | www.fujifilm.com |
| ELISPOT Reader with Immunospot Software | Cellular Technology Ltd | N/A |
| VersaMax Microplate Reader Using Softmax Pro 6.0 Software | Molecular Devices | Part# VERSAMAX |
| Other | ||
| Microneutralization (MN) Assay | WRAIR (Larocca et al. 2016) | N/A |