Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
sgRNA target sequences
| Target gene | sgRNA target sequence |
|---|---|
| CTLA4 | cgacgtaacagctaaaccca |
| GATA3 | ccgcagagggcggccgccgg |
| GATA1 | gcgaggtccaagaatcccca |
| EOS (IKZF4) | gcataccagacacataggag |
| RELA | gccccgccgccgcccggcgc |
| RELC | tcgcgcgcgcggcggccgcg |
| LEF1 | tccttggctgcccgctggag |
| IRF4 | cgctctccgggcgcggcgcg |
