Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Vesicular Stomatitis Virus) |
pVSV-FL+(2) Plasmid Expression Vector System | Kerafast | Cat#EH1002 | Anti-genomic sense plasmid with helper plasmids N, P, G and L |
| Genetic reagent (Mus musculus) | C57BL/6J-Tg(Cd4-CD4,CCR5)A1Bsz; C57BL/6J-Tg(Cd4-CD4,CCR5)C18Bsz; C57BL/6J-Tg(Cd4-CD4,CCR5)B4Bsz | This paper | Mouse lines with CD4 cell-specific expression of human CD4 and CCR5 | |
| Cell line (H. sapiens) | 293T | ATCC | CRL-3216 | |
| Cell line (H. sapiens) | GHOSTX4; GHOSTR5 | NIH AIDS Reagent Repository | Cat#3685;3944 | |
| Cell line (H. sapiens) | MT2 | NIH AIDS Reagent Repository | Cat#237 | |
| Antibody | Anti-mouse CD16/CD32 (purified rat monoclonal) | BD Pharmingen | Cat#553142 | FACS (2 uL per test) |
| Antibody | FITC Anti-mouse CD3 (rat monoclonal) | BD Pharmingen | Cat#555274 | FACS (2 uL per test) |
| Antibody | PerCP-Cy5.5 Anti-mouse CD4(rat monoclonal) | BD Pharmingen | Cat#550954 | FACS (2 uL per test) |
| Antibody | APC Anti-mouse CD8a (rat monoclonal) | Biolegend | Cat#100712 | FACS (1 uL per test) |
| Antibody | APC-Cy7 Anti-human CD4(mouse monoclonal) | Biolegend | Cat#317418 | FACS (2 uL per test) |
| Antibody | PE Anti-mouse CD19 (rat monoclonal) | BD Pharmingen | Cat#553786 | FACS (1 uL per test) |
| Antibody | PE Anti-human CD195/CCR5 (mouse monoclonal) | BD Pharmingen | Cat#560935 | FACS (2.5 uL per test) |
| Antibody | PE Anti-human CD195 (mouse monoclonal) | BD Pharmingen | Cat#550632 | FACS (2.5 uL per test) |
| Antibody | AlexaFluor 647 Anti-human CD4 (mouse monoclonal) | Biolegend | Cat#300520 | FACS (3 uL per test) |
| Antibody | Anti-HIV-1 gp120 (goat polyclonal) | American Research Products | Cat#12-6205-1 | WB (1:1000) |
| Antibody | Anti-VSV M (mouse monoclonal) | Kerafast | Cat#EB0011 | WB (1:2000) |
| Antibody | His-Tag Antibody (pAb, Rabbit) | GenScript | A00174-40 | ELISA coating at 0.5 mg/ml |
| Antibody | Goat anti-mouse IgG H and L (HRP) preadsorbed | Abcam | Ab97040 | ELISA (1:20000) |
| Antibody | Goat anti-human IgG H and L (HRP) preadsorbed | Abcam | Ab97175 | ELISA (1:20000) |
| Recombinant DNA reagent | pLHCX hCD4 2A CCR5 (plasmid) | This paper | Retroviral vector with human CD4/CCR5 | |
| Recombinant DNA reagent | pNL1.1 (plasmid) | Promega | #N1001; GenB:JQ437370 | Nanoluciferase cDNA |
| Recombinant DNA reagent | pAAVCMV_BG505-His | This paper | plasmid expressing his-tagged BG505 SOSIP | |
| Recombinant DNA reagent | pAAVCMV_B41-His | This paper | plasmid expressing his-tagged B41 SOSIP | |
| Recombinant DNA reagent | pAAVCMV_Du422-His | This paper | plasmid expressing his-tagged Du422 SOSIP | |
| Recombinant DNA reagent | pAAVCMV_Zm197-His | This paper | plasmid expressing his-tagged Zm197 SOSIP | |
| Sequence-based reagent | RL413 | This paper | Genotyping PCR primer | GAACCTGGTGGTGATGAGAGCCACTCA |
| Sequence-based reagent | RL425 | This paper | Genotyping PCR primer | TGCTTGCTTTAACAGAGAGAAGTTCGT |
| Sequence-based reagent | RL509 | PMID: 16617693 | RT-qPCR primer | TGATACAGTACAATTATTTTGGGAC |
| Sequence- based reagent | RL510 | PMID: 16617693 | RT-qPCR primer | GAGACTTTCTGTTACGGGATCTGG |
| Chemical compound, drug | Maraviroc | NIH AIDS Reagent Repository | Cat#11580 |