REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse monoclonal anti-PLPBP antibody (clone 1G2)	OriGene	Cat# TA505162; RRID: AB_2622886
Rabbit polyclonal anti-SHMT2 antibody	abbexxa	Cat# abx128462
Rabbit polyclonal anti-PNPO antibody	Sigma	Cat# HPA023204; RRID: AB_1855506
Rabbit polyclonal anti-ALAS1 antibody	Thermo Fisher Scientific	Cat# PA5-57434; RRID: AB_2637832
Rabbit polyclonal anti-SHMT1 antibody	abcam	Cat# ab55736; RRID: AB_2285970
Goat anti-rabbit antibody conjugated to horseradish peroxidase	invitrogen	Cat# 32260
Goat anti-mouse antibody conjugated to horseradish peroxidase	invitrogen	Cat# 32230
Mouse monoclonal anti-PLK antibody	Santa Cruz Biotechnology, Inc.	Cat# sc-365173, RRID: AB_10708566
Rabbit polyclonal anti-PL antibody	GeneTex	Cat# GTX12625
Bacterial and Virus Strains
Escherichia coli Rosetta 2 (DE3)	Merck	Cat# 71400
Chemicals, Peptides, and Recombinant Proteins
PL1	Hoegl et al., 2018	N/A
PL2	Hoegl et al., 2018	N/A
PL3	Hoegl et al., 2018	N/A
Glycosylceramidase (GBA)	ProSpec	Cat# enz-908
Lysyl Endopeptidase	Wako	Cat# 125-05061
Trypsin, Sequencing grade	Promega	Cat# V5111
l-Penicillamine	TCI	Cat# P1370
d-Penicillamine	Acros Organics via Fisher Scientific	Cat# 10224750
BTTAA ligand	Jena Bioscience	Cat# CLK-067-25
Critical Commercial Assays
Roti Quant Universal	Roth	Cat# 0120.1
Pierce™ BCA Protein Assay Kit	Thermo Fisher Scientific	Cat# 23225
ECI western blotting substrate solution	Pierce	Cat# PIER80196
Ponceau S	Sigma	Cat# P3504
Deposited Data
raw files, Fasta files, and MaxQuant analysis to PRIDE	This manuscript	https://www.ebi.ac.uk/pride/archive/; PXD014771
Experimental Models: Cell Lines
Human HeLa cell line	ECACC via Sigma Aldrich	Cat# 93021013; RRID: CVCL_0030
Human K562 cell line	ECACC via Sigma Aldrich	Cat# 89121407; RRID: CVCL_0004
Human HCT116 cell line	ECACC via Sigma Aldrich	Cat# 91091005; RRID: CVCL_0291
Human HEK293 cell line	ECACC via Sigma Aldrich	Cat# 85120602; RRID: CVCL_0045
Oligonucleotides
hPLK forward primer (5’->3’): ggggacaagtttgtacaaaaaa gcaggctttgagaatctttattttcagggcgaggaggagtgccgggtg	eurofins	custom made
hPLK reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcacagcaccgtggcctgg	eurofins	custom made
SHMT1 forward primer (5’->3’): ggggacaagtttgtacaaaaa agcaggCtttgagaatctttattttcagggcacgatgccagtcaacgggg	eurofins	custom made
SHMT1 reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcagaagtcaggcaggccag	eurofins	custom made
PLPBP forward primer (5’->3’): ggggacaagtttgtacaaaaaa gcagGctttgagaatctttattttcagggctggagagctggcagcatgtcg	eurofins	custom made
PLPBP reverse primer (5’->3’): ggggaccactttgtacaagaaa gctgggtgtcagtgctcctgtgccacctc	eurofins	custom made
Recombinant DNA
Human cDNA library from HeLa	BioAcademia	Cat# 02-723
SHMT1 ORF clone, NM_004169	GeneScript	Cat# OHu21374
PLPBP ORF clone, NM_007198.3	GeneScript	Cat# OHu09065
SHMT1_pDest007	This manuscript	Addgene ID: 131229 (http://www.addgene.org)
hPLK_pDest007	This manuscript	Addgene ID: 131230 (http://www.addgene.org)
PLPBP_pDest007	This manuscript	Addgene ID: 131231 (http://www.addgene.org)
Software and Algorithms
MaxQuant software	MPI Biochemistry Martinsried	http://www.biochem.mpg.de/5111795/maxquant
Perseus software	MPI Biochemistry Martinsried	http://www.biochem.mpg.de/5111810/perseus
Gene Ontology annotation file	Ashburner et al., 2000	http://geneontology.org/page/download-go-annotations
Prism 6 software	GraphPad	RRID: SCR_002798
Protein Deconvolution Software	Thermo Fisher Scientific	Cat# IQLAAEGAB SFANOMBAQ
Other
InfiniteM200 PRO reader	TECAN	Cat# IN-MNANO
StrepTrap HP column	GE Healthcare	Cat# 28-9075
Superdex 200 10/300 GL	GE Healthcare	Cat# 17517501
Superdex 75 10/300 GL	GE Healthcare via Sigma Aldrich	Cat# GE17-5174-01
HiTrap Desalting column	GE Healthcare	Cat# 17-1408-01
SYPRO orange protein gel stain	Thermo Fisher Scientific	Cat# S6650
CFX96 Real-Time System	Bio-Rad	Cat# 20421
Roti-PVDF, 0.2 μm	Roth	Cat# 8989.1
Trans-Bot SD Semi-Dry Transfer Cell	Bio-Rad	Cat# 1703940
Luminescent LAS 4000 image analyzer	Fujifilm, ordered via GE Healthcare	Cat# 28955810
Sep-Pak C18 columns	Waters	Cat# WAT054960