REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
APC/Cy7 anti-human CD14 Antibody | Biolegend | Cat#325620; RRID:AB_830693 |
APC/Cy7 Mouse IgG1 κ Isotype Ctrl | Biolegend | Cat#400128 |
Alexa Fluor® 647 anti-human CD163 Antibody | Biolegend | Cat#333619; RRID:AB_2563474 |
Alexa Fluor® 647 Mouse IgG1, κ Isotype Ctrl | Biolegend | Cat#400130 |
FITC anti-human CD163 Antibody | Biolegend | Cat#333618; RRID:AB 2563094 |
FITC Mouse IgG1, κ Isotype Ctrl | Biolegend | Cat#400110 |
Brilliant Violet 605™ anti-human CD86 Antibody | Biolegend | Cat#305429; RRID:AB_11203889 |
Brilliant Violet 605™ Mouse IgG2b, κ Isotype Ctrl | Biolegend | Cat#400349 |
PE anti-human CD80 Antibody | Biolegend | Cat#305208; RRID:AB_314504 |
PE Mouse IgG1, κ Isotype Ctrl | Biolegend | Cat#400112 |
Human TruStain FcX | Biolegend | Cat#422302 |
Anti-Actin antibody produced in rabbit | Sigma Aldrich | Cat#A2066; RRID:AB_476693 |
Monoclonal Anti-β-Tubulin antibody produced in mouse | Sigma-Aldrich | Cat#T4026; RRID:AB_477577 |
Human Serpin E1/PAI-1 Antibody goat anti-human | R&D Systems | Cat#AF1786; RRID:AB_2187024 |
Human gp130 PE-conjugated Antibody | R&D Systems | Cat#FAB228P-025 |
Human IL-6 R alpha Fluorescein-conjugated Antibody | R&D Systems | Cat#FAB227F-025 |
Phospho-Stat3 (Tyr705) Antibody | Cell Signaling | Cat#9131; RRID:AB_331586 |
Stat3 (79D7) Rabbit mAb | Cell Signaling | Cat#4904 |
Phospho-p38 MAPK (Thr180/Tyr182) (D3F9) XP® Rabbit mAb | Cell Signaling | Cat#4511; RRID:AB_2139682 |
p38 MAPK Antibody | Cell Signaling | Cat#9212; RRID:AB_330713 |
Phospho-NF-KB p65 (Ser536) (93H1) Rabbit mAb | Cell Signaling | Cat#3033; RRID:AB_331284 |
NF-κB p65 (D14E12)XP (R) Rabbit mAb | Cell Signaling | Cat#8242; RRID:AB_10859369 |
Unconjugated rabbit anti-rat IgG Antibody | Vector Laboratories | Cat#AI-4000 |
Goat Biotinylated anti-rabbit IgG (H+L) | Vector Laboratories | Cat#BA-1000; RRID:AB_2313606 |
Goat Biotinylated anti-rat IgG (H+L) | Vector Laboratories | Cat#BA-9400; RRID:AB_2336202 |
DyLight 488 anti-rabbit IgG | Vector Laboratories | Cat#DI-1488; RRID:AB_2336402 |
Anti-F4/80 Antibody | Abcam | Cat#ab6640; RRID:AB_1140040 |
Anti-iNOS antibody | Abcam | Cat#ab15323; RRID:AB_301857 |
Anti-pSTAT3 antibody | Cell Signaling | Cat#9145L |
Anti-CD206 antibody | Abcam | Cat#64693 |
goat anti-rabbit 800CW | LI-COR | Cat#926–32211; RRID:AB_621843 |
donkey anti-mouse 680LT | LI-COR | Cat#926–68022; RRID:AB_10715072 |
donkey anti-goat 800CW | LI-COR | Cat#926–32214; RRID:AB_621846 |
donkey anti-goat 680LT | LI-COR | Cat#926–68024; RRID:AB_10706168 |
Anti-arginase I Antibody (H-52) | Santa Cruz | Cat#sc20150; RRID:AB_2058955 |
Cy™3 AffiniPure Donkey Anti-Rat IgG (H+L) | Jackson ImmunoResearch | Cat#712-165-153; RRID:AB_2340667 |
Anti-human PAI (inhibitory) antibody | Molecular Innovations | Cat#MA-8H9D4 |
LEAFtm Purified Mouse IgG1 K isotype cntr | Biolegend | Cat#400124 |
Bacterial and Virus Strains | ||
Biological Samples | ||
Chemicals, Peptides, and Recombinant Proteins | ||
puromycin | Sigma-Aldrich | Cat#P9620 |
Histopaque | Sigma-Aldrich | Cat#10771–500ML |
0.1% Poly-L-Lysine solution | Sigma-Aldrich | Cat#P8920 |
Sodium butyrate | Sigma-Aldrich | Cat#B5887 |
BMS-345541 | Sigma-Aldrich | Cat#B9935–5MG |
Doxycycline hyclate | Sigma-Aldrich | Cat#D9891–25g |
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) | Sigma-Aldrich | Cat#H3375 |
Penicillin-Streptomycin (10,000 U/mL) | Gibco | Cat#15140–122 |
Cell Dissociation buffer, Enzyme free, PBS | Gibco | Cat#13151–014 |
Geneticin | Gibco | Cat#10131-035 |
Falcon® Permeable Support for 24 Well Plate with 8.0μm Transparent PET Membrane | Corning | Cat#353097 |
Dulbecco’s Modified Eagle’s Medium (DMEM) | Corning | Cat#10-013-CV |
phosphate-buffered saline (PBS) | Corning | Cat#21–031-CV |
Roswell Park Memorial Institute (RPMI) | Corning | Cat#10-040-CV |
DAPI | Thermo Fisher Scientific | Cat#D21490 |
HaltTM Protease and Phosphatase inhibitor single use cocktail | Thermo Fisher Scientific | Cat#78442 |
AmpFLSTR Identifiler PCR Kit | Thermo Fisher Scientific | Cat#4322288 |
Human PAI-1 (stable mutant form) | Molecular Innovations | Cat#CPAI |
Human PAI-1 (stable mutant, no LRP binding) | Molecular Innovations | Cat#HPAI-R76E-I91L |
Human PAI-1 (substrate form - P12 Arginine P14 Arginine double mutant) | Molecular Innovations | Cat#HPAI-RR |
Low Endotoxin Human RAP | Molecular Innovations | Cat#RAP-LE |
Vectashield antifade mounting medium with DAPI | Vector Laboratories | Cat#H-1200 |
Vectastain ELITE ABC-HRP peroxidase kit | Vector Laboratories | Cat#PK-6100 |
Antigen unmasking solution | Vector Laboratories | Cat#H-3300 |
Bloxall | Vector Laboratories | Cat#SP-6000 |
ImmPACTTM DAB | Vector Laboratories | Cat#SK-4105 |
Methyl Greene | Vector Laboratories | Cat#H-3402 |
Tris(hydroxymethyl)aminomethane (Tris) | Invitrogen | Cat#15504-020 |
Lipofectamine 2000 | Invitrogen | Cat#11668019 |
ER retrieval solution pH 6.0 BOND Novocastra | Leica | Cat#RE7113-CE |
Bond Polymer Refine Red detection kit | Leica Biosystems | Cat#DS9390 |
Actemra (Tocilizumab) | Genentech | Cat#NDC 50242135-01 |
Tiplaxtinin | Axon Medchem | Cat#Axon1383 |
4–15% Mini-Protean® TGXTM Precast Protein gels | BIO-RAD | Cat#456-1084 |
siLentFectTMLipid Reagent for RNAi,0.5 ml | BIO-RAD | Cat#1703360 |
Ruxolitinib | Selleckchem | Cat#S1378 |
0.45 μM syringe filters | VWR International | Cat#28145-479 |
SB203580 | Cell Signaling | Cat#5633 |
Cytoseal XYL | Richard-Allan Scientific | Cat#8312-4 |
EasySepTM Human Monocyte Enrichment Kit | StemCell | Cat#19059 |
Odyssey Blocking Buffer (PBS) | LI-COR | Cat#927-40000 |
Proteinase K, recombinant PCR grade | Roche | Cat#03115828001 |
Fetal Bovine Serum (Tetracycline-free) | Omega Scientific | Cat#FB-15 |
Hema 3 stain set for Wright-Giemsa stain | Protocol | Cat#123–869 |
MycoAlert Mycoplasma detection kit | Lonza | LT07-118 |
Critical Commercial Assays | ||
Human IL-12/IL-23 p40 DuoSet, 5 Plate | R&D Systems | Cat#DY1240-05 |
Human IL-10 DuoSet,5 Plate | R&D Systems | Cat#DY217B-05 |
Human IL-6 DuoSet, 15 Plate | R&D Systems | Cat#DY206 |
Mouse IL-10 DuoSet ELISA | R&D Systems | Cat#DY417-05 |
Proteome Profiler Human Phospho-Kinase Array Kit | R&D Systems | Cat#ARY003B |
EndoLISA® ELISA-based Endotoxin Detection Assay | Hyglos | Cat#609033 |
SuperScript® III First-Strand Synthesis System | Invitrogen | Cat#18080-051 |
Taqman IL-6 assay 4331182 | Applied Biosystems | Cat#Hs00985639_m1 |
Taqman GAPDH assay 4331182 | Applied Biosystems | Cat#Hs03929097_g1 |
TaqMan® Universal Master Mix II, no UNG | Applied Biosystems | Cat#4440040 |
Taqman ACTB assay 4331182 | Applied Biosystems | Cat#Hs99999903_m1 |
Taqman 18S assay 4453320 | Applied Biosystems | Cat#Hs99999901_s1 |
Deposited Data | ||
Experimental Models: Cell Lines | ||
Human Embryonic Kidney 293 cells | ATCC | Cat#CRL-1573 |
HT-1080 [HT1080] ATCC CCL-121TM | ATCC | Cat#CCL-121 |
A549 | Lieber et al., 1976 | N/A |
Experimental Models: Organisms/Strains | ||
Rag1−/− PAI-1−/− and Rag1−/− PAI-1+/+ immunodeficient female and male mice were obtained by mating PAI-1- deficient mice (PAI-1−/−) and their corresponding wild- type mice (PAI-1+/+) on a mixed genetic background of 87% C57BL/6 and 13% 129 strain [25] with Rag-1- deficient mice (Rag-1−/−: B6; 129 s-Rag-1tm/Mom/J) [26]. |
Carmeliet et al., 1993 Bajou et al., 2008 |
N/A |
Oligonucleotides | ||
ON-TARGET plus Set of 4 siRNA MAPK14 | Dharmacon | J-003512-20 |
ON-TARGET plus Set of 4 siRNA MAPK14 | Dharmacon | J-003512-20 |
ON-TARGET plus Set of 4 siRNA MAPK14 | Dharmacon | J-003512-20 |
ON-TARGET plus Set of 4 siRNA MAPK14 | Dharmacon | J-003512-20 |
ON-TARGET plus Set of 4 siRNA NF-κB p65 | Dharmacon | J-003533-06 |
ON-TARGET plus Set of 4 siRNA NF-κB p65 | Dharmacon | J-003533-06 |
ON-TARGET plus Set of 4 siRNA NF-κB p65 | Dharmacon | J-003533-06 |
ON-TARGET plus Set of 4 siRNA NF-κB p65 | Dharmacon | J-003533-06 |
ON-TARGET plus Non-targeting control | Dharmacon | D-001810-10-05 |
shPAI-1 5′- CCGGCAGACAGTTTCAGGCTGACTTCTCGAGAAGTCAGCC TGAAACTGTCTGTTTTT-3′ |
TRCN0000052271 | |
shPAI-2 5′- AATTAAAAACAGACAGTTTCAGGCTGACTTCTCGAGAAGT CAGCCTGAAACTGTCTG-3′ |
TRCN0000052271 | |
Scramble 1 5′- CCGGAATTCTCCGAACGTGTCACGTCTCGAGACGT |
N/A | |
GACACGTTCGGAGAATTTTTTT-3′ | ||
Scramble 2 5′- AATTAAAAAAATTCTCCGAACGTGTCACGTCTCGAGACGTG ACACGTTCGGAGAATT-3′ |
N/A | |
Recombinant DNA | ||
Tet-pLKO-puro lentiviral vector | Wee et al., 2008; Wiederschain et al., 2009 | Addgene Cat#21915 |
psPAX2 | Gift from Didier Trono lab | Addgene Cat#12260 |
pMD2.G | Gift from Didier Trono lab | Addgene Cat#12259 |
Software and Algorithms | ||
Other | ||