KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit monoclonal phospho JNK (Thr183/Tyrl85) (81E11) | Cell Signaling | Cat# 4668 |
| Rabbit Anti-Mouse JNK | Cell Signaling | Cat# 9252 |
| Rabbit Anti-Mouse phospho p65-NFκB (93H1) | Cell Signaling | Cat# 3033 |
| Rabbit Anti-Mouse p65-NFKB (D14E12) | Cell Signaling | Cat# 8242 |
| Rabbit Anti-Mouse phospho ERK1/2 (D13.14.4E) | Cell Signaling | Cat# 4370 |
| Rabbit Anti-Mouse ERK1/2 (137F5) | Cell Signaling | Cat# 4695 |
| Rabbit Anti-Mouse phospho p38-MAPK (12F10) | Cell Signaling | Cat# 4511 |
| Rabbit Anti-Mouse p38 MAPK (D13E1) | Cell Signaling | Cat# 8690 |
| Rabbit Anti-Mouse phospho MKK4 (C36C11) | Cell Signaling | Cat#4514 |
| Rabbit Anti-Mouse MKK4 | Cell Signaling | Cat#9152 |
| Rabbit Anti-Mouse phospho MKK3 (D8E9) | Cell Signaling | Cat# 12280 |
| Rabbit Anti-Mouse MKK3 (D4C3) | Cell Signaling | Cat# 8535 |
| Rabbit Anti-Mouse phospho c-Jun (D47G9) | Cell Signaling | Cat# 3270 |
| Rabbit Anti-Mouse c-Jun (60A8) | Cell Signaling | Cat#9165 |
| Rabbit Anti-Mouse phospho IRF3 (4D4G) | Cell Signaling | Cat# 4947 |
| Rabbit Anti-Mouse IRF3 (D83B9) | Cell Signaling | Cat# 4302 |
| Rabbit Anti-Mouse phospho STAT1 (58D6) | Cell Signaling | Cat#9167 |
| Rabbit Anti-Mouse STAT1 | Cell Signaling | Cat#9172 |
| Mouse anti-β-actin (8H10D10) | Cell Signaling | Cat# 3700 |
| Rabbit Anti-phospho GEFH1 | Abcam | Cat# ab74156 |
| Rabbit Anti-IRF5 | Abcam | Cat# ab21689 |
| Rabbit Anti-alpha Tubulin | Abcam | Cat# ab15246 |
| Sheep Anti-Mouse GEFH1 antibody | Exalpha Biologicals | Cat# X1089P |
| Anti-phospho IRF5 (Ser-445) | NeoBiolab (MA, USA) | N/A |
| Zombie UV Fixable Viability Kit | BioLegend | Cat# 423107 |
| Anti-Mouse TCRVb5-APC (clone MR9–4) (1:200 dilution) | BioLegend | Cat# 139505 |
| Anti-Mouse MHCII (l-A/l-E)-BV510 (clone M5/144.15.2) (1:200 dilution) | BioLegend | Cat# 107636 |
| Anti-Mouse CD11b-APC-Cy7 (clone M1/70) (1:200 dilution) | BioLegend | Cat# 101226 |
| Anti-Mouse CD86-APC (clone GL-1) (1:300 dilution) | BioLegend | Cat# 105012 |
| Anti-Mouse CD80-PE (clone 16–10A1) (1:300 dilution) | BioLegend | Cat# 104707 |
| Anti-Mouse CD45-APC-Cy7 (clone 30-F11) (1:300 dilution) | BioLegend | Cat# 103116 |
| Anti-Mouse CD40-BV421 (clone 3/23) (1:200 dilution) | BD Biosciences | Cat# 562846 |
| Anti-Mouse CD11-c-Pe-Cy7 (clone HL3) (1:200 dilution) | BD Biosciences | Cat# 561022 |
| Bacterial and Virus Strains | ||
| pSpCas9(BB)-2A-GFP (PX458) vector | Ran et al., 2013 | Addgene Plasmid; Cat# 48138 |
| GEFH1-C1-PH-GCN4 construct | This paper | N/A |
| GEFH1 sgRNA-pSpCas9(BB)-2A-GFP | This paper | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Ansamitocin-P3 | Cayman chemicals | Cat# 20538 |
| Dolastatin-10 | National Cancer Institute | N/A |
| Vinblastine | National Cancer Institute | N/A |
| Colchicine | Sigma Aldrich | Cat# C9754 |
| Nocodazole | Sigma Aldrich | Cat# M1404 |
| Etoposide | Sigma Aldrich | CAS: 33419-42-0 |
| Hyaluronidase | Sigma-Aldrich | Cat# H6354 |
| DNase type IV | Sigma-Aldrich | Cat# D5025; CAS: 9003-98-9 |
| Dimethyl sulfoxide (DMSO) | Sigma-Aldrich | Cat# D2650; CAS: 67-68-5 |
| Epothilone-A | Santa Cruz Biotechnology | Sc-207628; CAS: 152044-53-6 |
| Docetaxel | Selleckchem | Cat#S1148 |
| Paclitaxel | Cayman Chemicals | Cat# 10461; CAS: 33069-62-4 |
| CW190 | Prof. Altmnann, ETH Zurich | N/A |
| Accutase | Sigma Aldrich | A6964 |
| EndoFit Endotoxin-free ovalbumin protein | InVivo Gen | vac-pova-100 |
| Lipopolysaccharide from Escherichia coli 0111:B4 | InVivo Gen | Ultrapure LPS, E. coli 0111:B4 |
| Collagenase Type 4 | Worthington | Cat#LS004189 |
| CellTrace Violet | Molecular Probes | Cat# C34557 |
| Phosphatase Inhibitor (PhosSTOP) | Roche | Cat# 4906845001 |
| Protein G Plus/Protein A Agarose | Calbiochem | Cat#IP0414ML |
| SDS-PAGE sample buffer | Bio-Rad | Cat# 1610747 |
| ECL Western Blotting Detection reagents | GE Healthcare | Cat# GERPN2209 |
| Plinabulin | BeyondSpring Pharmaceuticals | N/A |
| Eribulin | Eisai Co. Ltd | N/A |
| MMAE | Seattle Genetics | N/A |
| DM1 | Concortis Biosystems | N/A |
| Critical Commercial Assays | ||
| EasySep Mouse CD11c Positive Selection Kit II | STEMCELL Technologies | Cat #18780 |
| IL-1β Mouse ELISA kit | eBioscience | Cat# BMS6002 |
| IL-6 Mouse ELISA kit | eBioscience | Cat# BMS603–2 |
| IL-12 Mouse ELISA kit | eBioscience | Cat# BMS616 |
| IC Fixation buffer | eBioscience | Cat# 00-8222-49 |
| Mouse CD4+ T Cell Isolation Kit | Miltenyi Biotec | Cat# 130-104-454 |
| Mouse CD8a+ T Cell Isolation Kit | Miltenyi Biotec | Cat# 130-104-075 |
| RNeasy kit | QIAGEN | Cat#74104 |
| iScript cDNA synthesis kit | Bio-Rad | Cat#1708890 |
| SsoAdvanced Universal SYBR Green supermix kit | Bio-Rad | Cat# 172–5270 |
| TruSeq Stranded mRNA sample preparation kit | Illumina | Cat# 20020594 |
| Kapa Biosystems library quantification kit | Roche | N/A |
| Deposited Data | ||
| Raw RNaseq data | This paper | GEO:GSE135264 |
| Experimental Models: Cell Lines | ||
| COS-7 fibroblasts cells | American Type Culture Collection (ATCC) | N/A |
| SP37A3 (immature dendritic cell line) | Merck KGaA | |
| XS106 cell line | Professor Akira Takashima, University of Texas, USA | N/A |
| NS47 fibroblast cell line | Professor Akira Takashima, University of Texas, USA | N/A |
| XS106 GEFH1−/− | This paper | N/A |
| E.coli Bl21 (DE3) cells | NEB Biolabs | Cat# C2527I |
| Experimental Models: Organisms/Strains | ||
| Mouse: C57BL/6NRj wild type | In house | N/A |
| Mouse: OT-I (B6.129S6-Rag2tm1Fwa Tg(TcraTcrb) 11OOMjb) | In house | N/A |
| Mouse: OT-II (B6.129S6 Rag2tm1Fwa Tg(TcraTcrb) 425Cbn) | In house | N/A |
| Mouse: 129S.Zbtb46tm1Kmm/J | The Jackson Laboratories | Stock No: 000690 |
| Mouse: GEFH1−/−(B6.Arhgef2 < tm1 Hcr >) | In house | N/A |
| Oligonucleotides | ||
| Primer Il1b-Forward: GCAACTGTTCCTGAACTCAACT | Microsynth | N/A |
| Primer Il6-Forward: CCTAGTTGTGATTCTTTCGATGCT | Microsynth | N/A |
| Primer Il12a-Forward: AGACATCACACGGGACCAAAC | Microsynth | N/A |
| Primer IL12b-Forward: TGGTTTGCCATCGTTTTGCTG | Microsynth | N/A |
| Primer CD80-Forward: TCGTCTTTCACAAGTGTCTTCAG | Microsynth | N/A |
| Primer CD86-Forward: GAAGCCGAATCAGCCTAGC | Microsynth | N/A |
| Primer Gapdh-Forward: TGACCTCAACTACATGGTCTACA | Microsynth | N/A |
| GEFH1 guide RNA_1: GCACATGGTCATGCCGGAGA | Microsynth | N/A |
| GEFH1 guide RNA_2: GACAAGGTAGGAGTCAGCCT | Microsynth | N/A |
| Software and Algorithms | ||
| Volocity | PerkinElmer | N/A |
| NIS-Elements imaging software | Nikon | N/A |
| ISMARA | https://ismara.unibas.ch | N/A |
| GraphPad Prism 7 | GraphPad Software | N/A |
| FlowJo | https://www.flowjo.com/ | N/A |
| Blc2fastq2 Conversion software | https://support.illumina.com/sequencing/sequencing_software/bcl2fastq-conversion-software.html | N/A |
| Cuffdiff version 1.05 | https://software.broadinstitute.org/cancer/software/genepattern/modules/docs/Cuffdiff/7 | N/A |
| Seqmonk | https://www.bioinformatics.babraham.ac.uk/projects/seqmonk/ | N/A |
| STAR (2.5.2a) | Devred et al., 2010 | N/A |
| edgeR Bioconductor Package in R | https://www.r-project.org | N/A |
| R package ComplexHeatmap | https://bioconductor.org/packages/release/bioc/html/ComplexHeatmap.html | N/A |
| HCOP: Orthology Predictions Search | http://www.genenames.org/cgi-bin/hcop at 8.9.17 | N/A |
| GSEA Java application | http://software.broadinstitute.org/gsea/index.jsp | N/A |
| LM22 matrix | Newman et al., 2015 | N/A |
| R package TCGAbiolinks | Colaprico et al., 2016 | N/A |
| Cox regression analyses | Sauerbrei et al., 2007 | N/A |