Table 2.

Mutational profile of AML#2 at diagnosis and relapse.

Pt	Gene	Locus	NM_ID	Exon	Type	Coding	Amino acid change	VAF (%)	Variant effect
AML#2Dx	DNMT3A	chr2:25458586	NM_022552.4	22	INDEL	c.2586_2587ins∗	p.Glu863Ser	35.79	Nonsense
	TET2	chr4:106155491	NM_001127208.2	3	INDEL	c.395delA	p.Asn132fs	38.55	fs del
	TET2	chr4:106197168	NM_001127208.2	11	INDEL	c.5504delG	p.Gly1835fs	43.60	fs del
	NPM1	chr5:170837545	NM_002520.6	11	INDEL	c.863_864insCTTG	p.Trp288fs	37.41	fs ins
	FLT3	chr13:28608308	NM_004119.2	14	INDEL	c.1747_1748ins∗∗	p.Gly583_Ser584ins∗∗∗	11.70	Nonfs ins
AML#2R	DNMT3A	chr2:25458586	NM_022552.4	22	INDEL	c.2586_2587ins∗	p.Glu863Ser	42.45	Nonsense
	TET2	chr4:106155491	NM_001127208.2	3	INDEL	c.395delA	p.Asn132fs	48.34	fs del
	TET2	chr4:106197168	NM_001127208.2	11	INDEL	c.5504delG	p.Gly1835fs	49.65	fs del
	NPM1	chr5:170837545	NM_002520.6	11	INDEL	c.863_864insCTTG	p.Trp288fs	42.87	fs ins
	WT1	chr11:32417943	NM_024426.4	7	SNV	c.1109G > C	p.Arg370Pro	48.25	Missense
	FLT3	chr13:28608308	NM_004119.2	14	INDEL	c.1747_1748ins∗∗	p.Gly583_Ser584ins∗∗∗	40.10	Nonfs ins

Pt: patient; Dx: diagnosis; R: relapse; SNV: single-nucleotide variant; INDEL: insertion/deletion; ins: insertion; fs: frameshift; del: deletion; ^∗insertion of 35 nucleotides: TCATGAATGAGAAAGAGGACATCTTATGGTGCAC; ^∗∗insertion of 57 nucelotides: GCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCCA; ^∗∗∗SerSerAspAsnGluTyrPheTyrValAspPheArgGluTyrGluTyrAspProSer.