| Antibodies |
|
|
| Monoclonal ANTI-FLAG M2 antibody produced in mouse |
Millipore |
Product #: F1804; RRID:AB_262044 |
| USP9X/Y Antibody (E-12) |
Santa Cruz |
Cat #: sc-365353; RRID:AB_10846088 |
| WWP1 monoclonal antibody (M01), clone 1A7 |
Abnova |
Catalog #: H00011059-M01; RRID:AB_509107 |
| Dvl2 Antibody #3216 |
Cell Signaling Technology |
Product # 3216S; RRID:AB_2093338 |
| GAPDH (14C10) Rabbit mAb #2118 |
Cell signaling technology |
Product # 2118S; RRID:AB_561053 |
| USP24 (S-18) antibody |
Cell Signaling Technology |
Catalog #: sc-82080; RRID:AB_2212766 |
| Anti-beta Catenin antibody [E247] |
Abcam |
ab32572; RRID:AB_725966 |
| Tubulin antibody |
Vanderbilt Antibody and Protein Resource Core |
N/A |
| NEDD4L Antibody #4013 |
Cell Signaling Technology |
Product # 4013S; RRID:AB_1904063 |
| WWP2 (AIP2) Antibody (A-3) |
Santa Cruz |
Catalog #: sc-398090; RRID:AB_2288586 |
| HA antibody |
Vanderbilt Antibody and Protein Resource Core |
N/A |
| Alpha adaptin antibody (AP2A1) AC1-M11 |
Thermo Fisher |
Cat #: MA3–061; RRID:AB_2056321 |
| Anti-AP2M1 antibody [EP2695Y] |
Abcam |
ab75995; RRID:AB_1309955 |
| Anti-VANGL1 |
Sigma |
Product #: HPA025235; RRID:AB_1858718 |
| Cofilin (D3F9) XP Rabbit mAb |
Cell Signaling Technology |
D3F9; RRID:AB_10622000 |
| Anti-Rho (-A, -B, -C) clone 55 |
Millipore Sigma |
Catalog # 05–778; RRID:AB_309989 |
| Anti-HA magnetic beads |
Pierce |
Catalog # 88836 |
| Chemicals, Peptides, and Recombinant Proteins |
|
|
| WP1130 |
UBPBio |
Cat #: F2120 |
| MG-132 |
APExBIO |
Cat #: A2585 |
| Phenanthroline |
Sigma-Aldrich |
Cat #: P9375 |
| Iodoacetamide |
Sigma-Aldrich |
Cat #: I1149 |
| LGK-974 |
Selleck Chem |
Catalog No.S7143 |
| Recombinant Human/mouse Wnt5a |
R&D System |
Cat #: 645-WN |
| WWP1 Active human recombinant, expressed in baculovirus infected insect cells |
Sigma-Aldrich |
Prod #: SRP0229 |
| USP9x-His6, isoform 2, human recombinant |
Boston Biochem |
Cat. # E-552 |
| Recombinant OTUB1 |
UBPBio |
Catalog #: H3000 |
| AMSH, human recombinant |
Boston Biochem |
Cat. # E-548B |
| GST-Ubiquitin E1 Enzyme (UBE1), S.cer. recombinant |
Boston Biochem |
Cat. # E-300 |
| Recombinant Human UbcH5c/UBE2D3 |
Boston Biochem |
Cat. # E2627 |
| Recombinant Mouse Wnt-3a |
R&D Systems |
Cat #: 1324-WN |
| Recombinant Mouse R-spondin |
R&D Systems |
Cat #: 3474-RS |
| Corning® Collagen I, Rat Tail |
Corning |
Product #: 354236 |
| Heavy Lysine: L-Lysine-13C6,15N2 hydrochloride |
Sigma-Aldrich |
Product #: 608041 |
| Heavy Arginine: L-Arginine-13C6,15N4 hydrochloride |
Sigma-Aldrich |
Product #: 608033 |
| Critical Commercial Assays |
|
|
| Steady Glo Luciferase Assay System |
Promega |
Catalog #: E2510 |
| Dual Glo Luciferase Assay System |
Promega |
Catalog #: E2920 |
| Rho Activation Assay Kit |
Millipore Sigma |
Catalog #: 17–294 |
| Experimental Models: Cell Lines |
|
|
| Human cells: MDA-MB-231 cells |
ATCC |
Product #: MDA-MB-231 (ATCC® HTB-26); RRID:CVCL_0062 |
| Human cells: HEK293 cells |
ATCC |
Product #: 293 [HEK293] (ATCC® CRL-1573; RRID:CVCL_0045 |
| Human cells: HEK293 STF |
ATCC |
Product #: HEK293 STF (ATCC® CRL-3249); RRID:CVCL_AQ26 |
| Human cells: MDA-MB-231 cells stably expressing FLAG-DVL2, FLAG-DUB-DVL2, or FLAG-DUB*-DVL2 |
This paper |
N/A |
| Human cells: MDA-MB-231 usp9x KO cells ± FLAG-DVL2 |
This paper |
N/A |
| Oligonucleotides |
|
|
| Control siRNA: orKKJ1 s, nonsilencing/pGL2 sense, CGUACGCGGAAUACUUCGAUU |
This paper |
N/A |
| Usp9x siRNA #1 sequence: AGAAAUCGCUGGUAUAAAUU |
This paper |
N/A |
| Usp9x siRNA #2 sequence: ACACGAUGCUUUAGAAUUUU |
This paper |
N/A |
| Nedd4L siRNA #1 sequence: GCUAGACUGUGGAUUGAGUUU |
This paper |
N/A |
| Nedd4L siRNA #2 sequence: UGAGGAUCAUUUGUCCUACUU |
This paper |
N/A |
| WWP1 siRNA #1 sequence: GAAGUCAUCUGUAACUAAAUU
|
This paper |
N/A |
| WWP1 siRNA #2 sequence: GCAGAGAAAUACUGUUUAUUU
|
This paper |
N/A |
| WWP2 siRNA #1 sequence: GGGAGAAGAGACAGGACAAUU
|
This paper |
N/A |
| WWP2 siRNA #2 sequence: CAGGAUGGGAGAUGAAAUAUU
|
This paper |
N/A |
| VANGL1 Silencer Select siRNA |
Thermo Fisher |
Catalog #: 4392420 |
| Recombinant DNA |
|
|
| Plasmid: FLAG-Wwp1 |
This paper |
N/A |
| Plasmid: FLAG-Wwp1-ww1 (W377F, P380A) |
This paper |
N/A |
| Plasmid: FLAG-Wwp1-ww2 (W409F, P412A) |
This paper |
N/A |
| Plasmid: FLAG-Wwp1-ww3 (W484F, P487A) |
This paper |
N/A |
| Plasmid: FLAG-Wwp1-ww4 (F524A, P527A) |
This paper |
N/A |
| Plasmid: FLAG-Wwp1–4ww (W377F, P380A, W409F, P412A, W484F, P487A, F524A, P527A) |
This paper |
N/A |
| Plasmid: FLAG-Wwp1-WW1 (W409F, P412A, W484F, P487A, F524A, P527A) |
This paper |
N/A |
| Plasmid: FLAG-Wwp1-WW2 (W377F, P380A, W484F, P487A, F524A, P527A) |
This paper |
N/A |
| Plasmid: FLAG-Wwp1-WW3 (W377F, P380A, W409F, P412A, F524A, P527A) |
This paper |
N/A |
| Plasmid: FLAG-Wwpw-WW4 (W377F, P380A, W409F, P412A, W484F, P487A) |
This paper |
N/A |
| Plasmid: FLAG-DVL2 PY1: FPAY393 → FAAA393
|
This paper |
N/A |
| Plasmid: FLAG-DVL2 PY2: PPPY568 → PAPA568
|
This paper |
N/A |
| Plasmid: FLAG-DVL2 2PY: FPAY393 → FAAA393 and PPPY568 → PAPA568 |
This paper |
N/A |
| Plasmid: USP9X1–2433, or usp9x-Δpy3–4: NPQY2437 → NAQA2437 (py3) and APLY2515 → AALA2515 (py4) |
This paper |
N/A |
| Plasmid: UL36-DVL2 |
Stringer and Piper (2011); Kattenhorn et al. (2005)
|
N/A |
| Plasmid: UL36 (C65A) catalytic dead-DVL2 |
Stringer and Piper (2011); Kattenhorn et al. (2005)
|
N/A |
| Plasmid: FLAG-DVL2-K0 (all lysines K → R) |
This paper |
N/A |
| Plasmid: FLAG-USP9X |
This paper |
N/A |
| Plasmid: FLAG-USP9X (C1556V) catalytic dead |
This paper |
N/A |
| Plasmid: FLAG-WWP1 (C890S) catalytic dead |
This paper |
N/A |
| Plasmid: GFP-DVL2 |
This paper |
N/A |
| Plasmid: GFP-DVL2-K0 (all lysines K → R) |
This paper |
N/A |
| Plasmid: GFP-WWP1 |
This paper |
N/A |
| Plasmid: GFP-USP9X |
This paper |
N/A |
| Software and Algorithms |
|
|
| SoftWorx |
GE |
N/A |
| MaxQuant |
Max Planck Institute of Biochemistry |
N/A |
| ImageJ |
NIH |
N/A |
| ImageStudioLite software |
LICORE |
N/A |
