Skip to main content
. Author manuscript; available in PMC: 2019 Nov 30.
Published in final edited form as: Pediatr Neurol. 2017 Sep 6;77:61–66. doi: 10.1016/j.pediatrneurol.2017.09.003

Table 1.

Diagnostic yield from 339 epilepsy patients screened on the Epilepsy and Seizure disorders panel.

Pathogenic and Likely Pathogenic variants
Case No. Gene Nucleotide Protein Classification Phenotype (if provided)
1 ALDH7A1 c.1093+1G>A, c.1279G>C p.Glu427Gln Pathogenic Seizures, epileptic encephalopathy, macrocephaly, hypotonia, muscle weakness, and developmental delay
2 ARX c.30C>A p.Cys10Ter Pathogenic Infantile spasms, dysphagia, and poor weight gain
3 CDKL5 c.1891_1916delATAGGGCAAGGGATGGCAGCTAGAGC p.Ile631Glnfs*43 Pathogenic Unspecified Epilepsy
4 CDKL5 c.1152C>G p.Tyr384Ter Pathogenic Epileptic encephalopathy, myotonic and tonic-clonic seizures, and a course gyral pattern on brain imaging
5 CDKL5 c.1553delC p.Pro518Hisfs*5 Pathogenic Seizures and spasticity
6 CDKL5 c.212delA p.Asn71Thrfs*5 Pathogenic Infantile/epileptic spasms and hypotonia
7 CDKL5 c.1108_1109dupAA p.Asn370Lysfs*124 Pathogenic N/A
8 FOXG1 c.648_655delTTACTACC p.Tyr217Argfs*235 Pathogenic Unspecified Epilepsy
9 GABRA1 c.335G>A p.Arg112Gln Likely Pathogenic N/A
10 GABRA1 c.640C>A p.Arg214Ser Likely pathogenic Generalized convulsive epilepsy with intractable epilepsy
11 GRIN2A c.2890delC p.Gln964Lysfs*37 Pathogenic Generalized seizures and speech disturbance
12 GRIN2A c.3813G>A p.Trp1271Ter Pathogenic N/A
13 KCNA1 c.1222G>A p.Val408Met Likely Pathogenic Seizures, developmental delay, and multiple joint contractures
14 KCNQ2 c.793G>A p.Ala265Thr Likely pathogenic Neonatal seizure disorder
15 KCNQ2 c.637C>T p.Arg213Trp Pathogenic Neonatal seizure disorder
16 KCNQ2 c.640C>T p.Arg214Trp Likely pathogenic Autism, seizures, hydrocephaly, a brother with autism and epilepsy, and a father with a history of epilepsy in childhood
17 KCNQ2 c.1118+2T>C Pathogenic Infantile/epileptic spasms
18 KCNQ2 c.701C>T p.Thr234Ile Likely pathogenic Seizures and developmental delay
19 KCNQ2 c.821C>T p.Thr274Met Likely pathogenic N/A
20 KCNQ2 c.841G>A p.Gly281Arg Likely pathogenic N/A
21 KCNQ2 c.1088A>G p.Tyr363Cys Likely pathogenic Neonatal seizure disorder and epileptic encephalopathy
22 KCNT1 c.2849G>A p.Arg950Gln Likely Pathogenic N/A
23 MECP2 c.880C>T p.Arg294Ter Pathogenic Delayed milestones and intractable epilepsy
24 PCDH19 c.814C>T p.Gln272Ter Pathogenic Seizure disorder
25 PCDH19 c.1091dupC p.Tyr366Leufs*10 Pathogenic Intellectual disability, autism, and seizures
26 PCDH19 c.1265_1266delCA p.Thr422Asnfs*23 Pathogenic N/A
27 SCN1A c.2584C>T p.Arg862Ter Pathogenic Psychomotor epilepsy, intellectual disability, phenotype consistent with Dravet syndrome
28 SCN1A c.4907G>A p.Arg1636Gln Likely pathogenic Epileptic encephalopathy, myoclonic seizures, dystonia, and spasticity
29 SCN1A c.602+1G>A Pathogenic Seizures and developmental delay
30 SCN1A c.269T>C p.Phe90Ser Likely pathogenic Prolonged seizures, possible myoclonus, and a clinical suspicion for Dravet syndrome
31 SCN1A c.1264G>A p.Val422Met Likely pathogenic Infantile spasms, focal seizures, hypotonia, bilateral polydactyly, lack of coordination, and grand mal status
32 SCN1A c.1259C>A p.Ala420Asp Likely pathogenic N/A
33 SCN1A c.302G>A p.Arg101Gln Pathogenic N/A
34 SCN1A c.5389G>C p.Ala1797Pro Likely Pathogenic Tonic-clonic and focal seizures
35 SCN1A c.5348C>T p.Ala1783Val Pathogenic N/A
36 SCN1A c.4812delG p.Trp1604Ter Pathogenic N/A
37 SCN1A c.5563C>T p.Pro1855Ser Likely Pathogenic N/A
38 SCN1A c.1076A>G p.Asn359Ser Likely Pathogenic N/A
39 SCN1B c.347delC p.Ser116Trpfs*31 Pathogenic Hypotonia and seizures
40 SCN1B c.653delG p.Ser218Thrfs*21 Likely Pathogenic Developmental delay, seizures with an abnormal EEG, and high myopia
41 SCN1B c.363C>G pCys121Trp Pathogenic N/A
42 SCN1B c.363C>G pCys121Trp Pathogenic N/A
43 SCN2A c.5387_5390dup AGAT p.Met1797Ilefs*5 Pathogenic Seizures and intellectual disability
44 SCN2A c.5645G>A p.Arg1882Gln Likely pathogenic Lack of normal physiological development, autism spectrum disorder, and intractable epilepsy
45 SCN2A c.2558G>A p.Arg853Gln Pathogenic Failure to thrive, developmental delay, speech delay, autism, seizures, dystonia, microcephaly, and gastroesophageal reflux disease
46 SCN2A c.1178C>A p.Thr393Lys Likely Pathogenic Seizures and developmental regression
47 SCN2A c.2713A>G p.Lys905Glu Likely Pathogenic Epileptic encephalopathy
48 SCN8A c.3985A>G p.Asn1329Asp Likely pathogenic Intractable epilepsy
49 SCN8A c.2287A>G p.Ile763Val Likely Pathogenic Seizures and developmental delay
50 SLC2A1 c.997C>T p.Arg333Trp Pathogenic Febrile seizures, ataxia, hypotonia, hypermobility, and a family history of seizures.
51 SLC2A1 c.1006C>G p.Leu336Val Likely Pathogenic N/A
52 SLC9A6 c.508–1G>A Pathogenic N/A
53 STXBP1 c.1029+1G>T Pathogenic Seizures, developmental delay, and cognitive impairment.
54 STXBP1 c.364C>T p.Arg122Ter Pathogenic Infantile/epileptic spasms and tonic seizures
55 STXBP1 c.548T>C p.Leu183Pro Likely Pathogenic N/A
56 STXBP1 c.704G>A p.Arg235Gln Likely Pathogenic Generalized, absence, and tonic-clonic seizures, infantile spasms, hypotonia, developmental delay, and cerebral palsy
57 SYN1 c.377G>A p.Trp126Ter Pathogenic N/A
58 TPP1* c.509–1G>C Pathogenic N/A
59 TPP1 c.509–1G>C, c.1016G>A p.Arg339Gln Pathogenic Seizures and speech delay
60 TSC2 c.4415delG p.Gly1472Alafs*4 Pathogenic Seizure disorder and intellectual disability
61 TSC2 c.3598C>T p.Arg1200Trp Pathogenic Infantile spasms and global developmental delay
62 ZEB2 c.1876G>T p.Gly626Ter Pathogenic Developmental delay and psychomotor epilepsy
Potentially Causative Variants
Case No. Gene Nucleotide Protein Classification Phenotype (if provided)
63 CACNA1A c.5017C>T p.Arg1673Cys Unknown Generalized convulsive epilepsy and hemiplegia
64 CACNA1A c.4177G>A p.Val1393Met Unknown Global developmental delay, seizures, and tremor
65 CACNA1A c.4177G>A p.Val1393Met Unknown N/A
66 CDKL5 c.541G>A p.Glu181Lys Unknown N/A
67 HCN1 c.990G>C p.Trp330Cys Unknown Epileptic encephalopathy, abnormal EEG, and other clinical features suggestive of Ohtahara syndrome
68 FLNA c.4237G>A p.Glu1413Lys Unknown Hypotonia, epilepsy, and abnormal MRI
69 KCNQ2 c.1627G>A p.Val543Met Inherited Developmental delay, seizures, a ventricular septal defect, unilateral cryptorchidism, and macrocephaly
70 KCNQ2 c.1627G>A p.Val543Met Unknown N/A
71 KCTD7 c.190A>G, c.793G>A p.Thr64Ala, p.Gly265Arg Inherited from both parents Status epilepticus, generalized, tonic-clonic, and myoclonic seizures
72 MEF2C c.121T>C p.Cys41Arg Unknown Generalized and myoclonic seizures, intellectual disability, hypotonia, spasticity, and muscle weakness
73 NRXN1 c.3619C>T p.Arg1207Ter Unknown Autism, epilepsy, and developmental delay
74 PNKP* c.1324G>A p.Gly442Ser Unknown N/A
75 RELN c.1817C>T, c.2201T>A p.Thr606Ile, p.Val734Asp Inherited from both parents Cerebral palsy, abnormal EEG, developmental delay, and lack of coordination
76 SCN1A c.638C>G p.Ser213Trp Unknown Febrile and afebrile seizures and developmental delay
77 SCN1A c.1703G>A p.Arg568Gln Unknown Seizures
78 SCN1A c.2923G>C p.Val975Leu Unknown Seizures and developmental delay
79 SCN2A c.4156T>G p.Cys1386Gly Unknown Seizures, speech and developmental regression
80 SCN8A c.491C>T p.Thr164Met Inherited from affected mother Focal seizures, developmental delay, failure to thrive, and a maternal family history of seizures
81 SCN8A c.605T>A p.Ile202Asn Unknown Seizures, developmental delay, dysmorphic features, pica, paroxysmal behavior with nonspecific encephalopathy on EEG, and a brother who also has seizures
82 SCN8A c.1241A>T p.Tyr414Phe Unknown N/A
83 TPP1*‡ c.523C>T p.Arg175Cys Unknown Infantile spasms, learning disability, developmental delay, seizures, and hypotonia

N/A, phenotype was not available

*

Indicates a homozygous variant

‡

This individual also had a novel homozygous missense variant in SLC25A22