Table 3.
Strains, plasmids, and primers used in this study.
| Sample | Relevant Characteristics | Source, Reference |
|---|---|---|
| Strains | ||
| R. opacus 1 CP | Benzoate+, 4-hydroxybenzoate+, 3-chlorobenzoate+, phenol+, 4-chlorophenol+, 2,4-dichlorophenol+, 2-chlorophenol+, 3-methylphenol+, 4-methylphenol+, phthalate+, isophthalate+, n-alkanes+ (C10-C16), styrene+ | [73,64] |
| E. coli DH5α | fhuA2 Δ(argF-lacZ) U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 | NEB 1 |
| E. coli BL21(DE3) pLysS | fhuA2 [lon] ompT gal (λ DE3) [dcm] ∆hsdS λ DE3 = λ sBamHIo ∆EcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 ∆nin5 | NEB 1 |
| Plasmids | ||
| pEX-A2 | multiple cloning site, Lac-Promoter, pUC origin, Ampr | Eurofins 2 |
| pET16bP | pET16b with additional multiple cloning site; allows production of recombinant proteins with N-terminal Histidine10-Tag and gene expression induction with IPTG | Wehmeyer 3 |
| pEX-A2-RogalU1 | pEX-A2 vector with recombinant UDP-glucose-pyrophosphorylase gene 1 of R. opacus 1 CP (RogalU1) 914 bp, NCBI protein accession: ANS26426 | This study |
| pEX-A2-RogalU2 | pEX-A2 vector with recombinant UDP-glucose-pyrophosphorylase gene 2 of R. opacus 1 CP (RogalU2) 932 bp, NCBI protein accession: ANS26629 | This study |
| pET16bP-RogalU1 | pET16bP vector with recombinant UDP-glucose-pyrophosphorylase gene 1 of R. opacus 1 CP (RogalU1) | This study |
| pET16bP-RogalU2 | pET16bP vector with recombinant UDP-glucose-pyrophosphorylase gene 2 of R. opacus 1 CP (RogalU2) | This study |
| Primer | ||
| pET16bP-fw | 5’ - CATCACAGCAGCGGCCATATCGAAG - 3’ | This study |
| pET16bP-rev | 5’ - CAGCTTCTTTTCGGGCTTTGTTAG - 3’ | This study |
1 New England Biolabs Inc. or 2 Eurofins Genomics as a commercial source. 3 personal communication by U. Wehmeyer.