REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse monoclonal anti-FLAG antibody (clone M2) (Dilution for western blot 1:2000)	Sigma-Aldrich	Cat# F1804; RRID: AB_262044
Mouse monoclonal anti-Viral V5-TAG antibody (clone SV5-Pk1) (Dilution for western blot 1:5000)	Bio-Rad / AbD Serotec	Cat# MCA1360; RRID: AB_322378
Mouse monoclonal anti-Pgk1 antibody (clone 22C5D8) (Dilution for western blot 1:2000)	Thermo Fisher Scientific	Cat# 459250; RRID: AB_2532235
Mouse monoclonal anti c-MYC antibody (clone 9E10) (Dilution for western blot 1:2000)	In house	N/A
Mouse monoclonal anti-Rad53 antibody (clone EL7) (Dilution for western blot 1:5)	In house (Fiorani et al., 2008)	N/A
Rabbit polyclonal anti-GST antibody (Dilution for western blot 1:3000)	In house	N/A
Mouse monoclonal anti-HA (F-7) antibody (Dilution for western blot 1:2000)	Santa Cruz Biotechnology	Cat# sc-7392; RRID: AB_627809
Mouse monoclonal anti-Bromodeoxyuridine antibody (clone 2B1)	MBL International	Cat# MI-11-3; RRID: AB_590678
Rabbit polyclonal anti-Ubiquitin antibody (Dilution for western blot 1:2000)	Abcam	Cat# ab19247; RRID: AB_444805
Rabbit polyclonal anti-Clb2 (y-180) antibody (Dilution for western blot 1:2000)	Santa Cruz Biotechnology	Cat# sc-9071; RRID: AB_667962
Rabbit polyclonal anti-Smt3 (y-84) antibody (Dilution for western blot 1:2000)	Santa Cruz Biotechnology	Cat# sc-28649; RRID: AB_661135
Rabbit polyclonal anti-SUMO2/3 antibody (Dilution for western blot 1:2000)	Abcam	Cat# ab3742; RRID: AB_304041
Rabbit polyclonal anti-Mcm2-7 (UM185) antibody (Dilution for western blot 1:5000)	Gift from Stephen P. Bell (Bowers et al., 2004)	N/A
Rabbit polyclonal anti-Mcm4-phospho-S82-D83 antibody (Dilution for western blot 1:400)	Gift from Stephen P. Bell (Randell et al., 2010)	N/A
Anti-HA affinity matrix; (clone 3F10) rat monoclonal antibody	Roche	Cat# 11815016001; RRID: AB_390914
Anti-rabbit IgG, HRP-linked antibody (Dilution for western blot 1:5000)	Cell Signaling Technology	Cat# 7074; RRID: AB_2099233
Anti-mouse IgG, HRP-linked antibody (Dilution for western blot 1:5000)	Cell Signaling Technology	Cat# 7076; RRID: AB_330924
Normal mouse IgG	Santa Cruz Biotechnology	Cat# sc-2025; RRID: AB_737182
Chemicals, Peptides, and Recombinant Proteins
alpha-factor mating pheromone (WHWLQLKPGQPMY)	GenScript; RRID: SCR_002891	Cat# 59401-28-4
Recombinant human poly-SUMO3 wild-type K-11-linked chains (2-8)	Boston Biochem	Cat# ULC-310
Recombinant budding yeast N-terminally His-tagged wild-type SUMO (HisSUMO)	In house	N/A
Recombinant glutathione S-transferase (GST) and GST-Ulp2 fusion proteins (amino acids 1-400, wild-type or with mutated SUMO-interacting motifs)	In house	N/A
Nocodazole	Sigma-Aldrich	Cat# M1404
Imidazole	Sigma-Aldrich	Cat# I2399
Hydroxyurea	Sigma-Aldrich	Cat# H8627
Bromodeoxyuridine	Sigma-Aldrich	Cat# B9285
Ni-NTA agarose	QIAGEN	Cat# 30210
Recombinant protein G – Sepharose 4B	Thermo Fisher Scientific	Cat# 101243
Glutathione Sepharose 4B	GE Healthcare	Cat# 17-0756-01
Dynabeads protein A	Thermo Fisher Scientific	Cat# 10002D
cOmplete, EDTA-free protease inhibitor cocktail tablets	Roche	Cat# 4693132001
N-Ethylmaleimide	Sigma-Aldrich	Cat# E3876
Phenylmethanesulfonyl fluoride	Sigma-Aldrich	Cat# P7626
Iodoacetamide	Sigma-Aldrich	Cat# I1149
Phosphatase inhibitor cocktail 2	Sigma-Aldrich	Cat# P5726
Phosphatase inhibitor cocktail 3	Sigma-Aldrich	Cat# P0044
Zymolyase 100T (Arthrobacter luteus)	Seikagaku Corporation	Cat# 120493
Lambda protein phosphatase	New England Biolabs	Cat# P0753S
Ribonuclease A from bovine pancreas	Sigma-Aldrich	Cat# R5503
Proteinase K, recombinant, PCR Grade	Roche	Cat# 03115801001
4,5′,8-Trimethylpsoralen	Sigma-Aldrich	Cat# T6137
Agarose D1-LE	Fisher Molecular Biology	Cat# AS-101
Critical Commercial Assays
GenomePlex complete whole genome amplification (WGA) kit	Sigma-Aldrich	Cat# WGA2
GenomePlex WGA reamplification kit	Sigma-Aldrich	Cat# WGA3
QuantiFast SYBR Green PCR kit	QIAGEN	Cat# 204054
Genomic-tip 100/G	QIAGEN	Cat# 10243
QIAquick PCR purification kit	QIAGEN	Cat# 28106
ProbeQuant G-50 micro columns	GE Healthcare	Cat# 28903408
Prime-a-Gene labeling system	Promega	Cat# U1100
Invitrogen Bolt 4-12% Bis-Tris Plus Gels, 15-well	Thermo Fisher Scientific	Cat# NW04125BOX
L-Arginine:HCl (U-13C6, 99%; U-15N4, 99%)	Cambridge Isotope Laboratories	CAS# 1119-34-2
		CNLM-539-H-0.25
L-Lysine:2HCl (U-13C6, 99%; U-15N2, 99%)	Cambridge Isotope Laboratories	CAS# 657-26-1
		CNLM-291-H-0.25
Deposited Data
Raw and analyzed ChIP-on-chip and BrdU IP-on-chip data	This paper	GEO: GSE113835
Experimental Models: Organisms/Strains
All yeast Saccharomyces cerevisiae strains used in this work, except those used for yeast two-hybrid (Y2H) studies, are W303 background derivatives with the wild type RAD5 locus. They are listed in Table S2.	This paper	N/A
Y2HGold yeast strain	Takara	Cat# 630498
Oligonucleotides
Primer ARS305F for qPCR: CTCCGTTTTTAGCC CCCGTG	This paper	N/A
Primer ARS305R for qPCR:	This paper	N/A
GATTGAGGCCACAGCAAGACCG
Recombinant DNA
A6C-110	Newlon et al., 1991	N/A
pGAD-C1, pGBD-C1	James et al., 1996	N/A
pGEX-6P-2	GE Healthcare	Cat# 28-9546-50
Software and Algorithms
Affymetrix Tiling Analysis Software	Thermo Fisher Scientific	https://www.thermofisher.com/us/en/home/life-science/microarray-analysis/microarray-analysis-instruments-software-services/microarray-analysis-software/tiling-array-tools.html
UCSC Genome Browser	Kent et al., 2002	https://genome.ucsc.edu/
CEAS (Cis-regulatory Element Annotation System) package sitepro script	Shin et al., 2009	http://liulab.dfci.harvard.edu/CEAS/download.html
Cytobank	Kotecha et al., 2010	https://www.cytobank.org/
MaxQuant (version 1.5.2.8)	Cox and Mann, 2008	https://www.biochem.mpg.de/5111795/maxquant
Scaffold	Searle, 2010	http://www.proteomesoftware.com/products/scaffold/
Other
ULTImate yeast two-hybrid (Y2H) screen	Hybrigenics Services	https://www.hybrigenics-services.com/