Table 1.
Primer sequences 16 s Escherichia coli.
| Primer name (Target gene) |
Oligonucleotide sequence (5–3`)* |
Amplicon size (bp) |
|---|---|---|
| E16S (16S rRNA) | F: CCCCCTGGACGAAGACTGAC | 401 bp |
| R: ACCGCTGGCAACAAAGGATA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.